ID: 939788688

View in Genome Browser
Species Human (GRCh38)
Location 2:146546142-146546164
Sequence AGTTATCTGCAGAAGATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939788684_939788688 16 Left 939788684 2:146546103-146546125 CCCAGTAACAGGCCAAGAGTTGT 0: 17
1: 184
2: 186
3: 148
4: 230
Right 939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG No data
939788682_939788688 22 Left 939788682 2:146546097-146546119 CCAAACCCCAGTAACAGGCCAAG No data
Right 939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG No data
939788687_939788688 4 Left 939788687 2:146546115-146546137 CCAAGAGTTGTCTCTCAAAAGGA 0: 17
1: 200
2: 191
3: 170
4: 310
Right 939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG No data
939788685_939788688 15 Left 939788685 2:146546104-146546126 CCAGTAACAGGCCAAGAGTTGTC 0: 17
1: 171
2: 183
3: 131
4: 176
Right 939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG No data
939788683_939788688 17 Left 939788683 2:146546102-146546124 CCCCAGTAACAGGCCAAGAGTTG No data
Right 939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939788688 Original CRISPR AGTTATCTGCAGAAGATGCC AGG Intergenic
No off target data available for this crispr