ID: 939791185

View in Genome Browser
Species Human (GRCh38)
Location 2:146579106-146579128
Sequence CTTTGTGGATACTATTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939791185_939791193 11 Left 939791185 2:146579106-146579128 CCTTGATAATAGTATCCACAAAG No data
Right 939791193 2:146579140-146579162 GACACTGGTGTGATTATAGATGG No data
939791185_939791191 -4 Left 939791185 2:146579106-146579128 CCTTGATAATAGTATCCACAAAG No data
Right 939791191 2:146579125-146579147 AAAGGGTGCCAGGAGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939791185 Original CRISPR CTTTGTGGATACTATTATCA AGG (reversed) Intergenic
No off target data available for this crispr