ID: 939791190

View in Genome Browser
Species Human (GRCh38)
Location 2:146579121-146579143
Sequence TGTCCTCCTGGCACCCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939791190_939791193 -4 Left 939791190 2:146579121-146579143 CCACAAAGGGTGCCAGGAGGACA No data
Right 939791193 2:146579140-146579162 GACACTGGTGTGATTATAGATGG No data
939791190_939791194 22 Left 939791190 2:146579121-146579143 CCACAAAGGGTGCCAGGAGGACA No data
Right 939791194 2:146579166-146579188 GAAGAGTCTCAAAGTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939791190 Original CRISPR TGTCCTCCTGGCACCCTTTG TGG (reversed) Intergenic
No off target data available for this crispr