ID: 939791192

View in Genome Browser
Species Human (GRCh38)
Location 2:146579133-146579155
Sequence TAATCACACCAGTGTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939791192_939791194 10 Left 939791192 2:146579133-146579155 CCAGGAGGACACTGGTGTGATTA No data
Right 939791194 2:146579166-146579188 GAAGAGTCTCAAAGTGAAGAAGG No data
939791192_939791195 26 Left 939791192 2:146579133-146579155 CCAGGAGGACACTGGTGTGATTA No data
Right 939791195 2:146579182-146579204 AAGAAGGTTACAGTAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939791192 Original CRISPR TAATCACACCAGTGTCCTCC TGG (reversed) Intergenic
No off target data available for this crispr