ID: 939791194

View in Genome Browser
Species Human (GRCh38)
Location 2:146579166-146579188
Sequence GAAGAGTCTCAAAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939791192_939791194 10 Left 939791192 2:146579133-146579155 CCAGGAGGACACTGGTGTGATTA No data
Right 939791194 2:146579166-146579188 GAAGAGTCTCAAAGTGAAGAAGG No data
939791190_939791194 22 Left 939791190 2:146579121-146579143 CCACAAAGGGTGCCAGGAGGACA No data
Right 939791194 2:146579166-146579188 GAAGAGTCTCAAAGTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939791194 Original CRISPR GAAGAGTCTCAAAGTGAAGA AGG Intergenic
No off target data available for this crispr