ID: 939797061

View in Genome Browser
Species Human (GRCh38)
Location 2:146658149-146658171
Sequence TCCTTTCTTTAGAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939797061_939797065 -3 Left 939797061 2:146658149-146658171 CCCTTTACCTTCTAAAGAAAGGA No data
Right 939797065 2:146658169-146658191 GGAAGTTAGAATAAAAGCAAGGG No data
939797061_939797066 -2 Left 939797061 2:146658149-146658171 CCCTTTACCTTCTAAAGAAAGGA No data
Right 939797066 2:146658170-146658192 GAAGTTAGAATAAAAGCAAGGGG No data
939797061_939797067 1 Left 939797061 2:146658149-146658171 CCCTTTACCTTCTAAAGAAAGGA No data
Right 939797067 2:146658173-146658195 GTTAGAATAAAAGCAAGGGGTGG No data
939797061_939797064 -4 Left 939797061 2:146658149-146658171 CCCTTTACCTTCTAAAGAAAGGA No data
Right 939797064 2:146658168-146658190 AGGAAGTTAGAATAAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939797061 Original CRISPR TCCTTTCTTTAGAAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr