ID: 939806112

View in Genome Browser
Species Human (GRCh38)
Location 2:146777421-146777443
Sequence CAGCTCTAACAGCTTGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939806112_939806114 22 Left 939806112 2:146777421-146777443 CCAAATGCAAGCTGTTAGAGCTG No data
Right 939806114 2:146777466-146777488 ATAAAAAAAAATCACATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939806112 Original CRISPR CAGCTCTAACAGCTTGCATT TGG (reversed) Intergenic
No off target data available for this crispr