ID: 939806241

View in Genome Browser
Species Human (GRCh38)
Location 2:146778483-146778505
Sequence GACAGCTCTCGGCCTATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939806237_939806241 15 Left 939806237 2:146778445-146778467 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 939806241 2:146778483-146778505 GACAGCTCTCGGCCTATTACTGG No data
939806238_939806241 11 Left 939806238 2:146778449-146778471 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 939806241 2:146778483-146778505 GACAGCTCTCGGCCTATTACTGG No data
939806236_939806241 16 Left 939806236 2:146778444-146778466 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 939806241 2:146778483-146778505 GACAGCTCTCGGCCTATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939806241 Original CRISPR GACAGCTCTCGGCCTATTAC TGG Intergenic
No off target data available for this crispr