ID: 939806427

View in Genome Browser
Species Human (GRCh38)
Location 2:146779856-146779878
Sequence ATGCTGATTCAGAGCGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939806427_939806430 10 Left 939806427 2:146779856-146779878 CCATGTACGCTCTGAATCAGCAT No data
Right 939806430 2:146779889-146779911 CCACTGTTTCCCCCATATCCAGG No data
939806427_939806433 19 Left 939806427 2:146779856-146779878 CCATGTACGCTCTGAATCAGCAT No data
Right 939806433 2:146779898-146779920 CCCCCATATCCAGGATTGATGGG No data
939806427_939806431 18 Left 939806427 2:146779856-146779878 CCATGTACGCTCTGAATCAGCAT No data
Right 939806431 2:146779897-146779919 TCCCCCATATCCAGGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939806427 Original CRISPR ATGCTGATTCAGAGCGTACA TGG (reversed) Intergenic
No off target data available for this crispr