ID: 939813776

View in Genome Browser
Species Human (GRCh38)
Location 2:146869022-146869044
Sequence TAACCTGGCTGATTAATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939813774_939813776 28 Left 939813774 2:146868971-146868993 CCACAGTTGTCACAGTATCATAA No data
Right 939813776 2:146869022-146869044 TAACCTGGCTGATTAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939813776 Original CRISPR TAACCTGGCTGATTAATTCA AGG Intergenic