ID: 939813776 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:146869022-146869044 |
| Sequence | TAACCTGGCTGATTAATTCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939813774_939813776 | 28 | Left | 939813774 | 2:146868971-146868993 | CCACAGTTGTCACAGTATCATAA | No data | ||
| Right | 939813776 | 2:146869022-146869044 | TAACCTGGCTGATTAATTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939813776 | Original CRISPR | TAACCTGGCTGATTAATTCA AGG | Intergenic | ||