ID: 939814216

View in Genome Browser
Species Human (GRCh38)
Location 2:146874108-146874130
Sequence CTCAGTGTACAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939814216_939814221 23 Left 939814216 2:146874108-146874130 CCTTGCTCCATCTGTACACTGAG No data
Right 939814221 2:146874154-146874176 AAATGATAAAGAAAGTATTCAGG No data
939814216_939814222 24 Left 939814216 2:146874108-146874130 CCTTGCTCCATCTGTACACTGAG No data
Right 939814222 2:146874155-146874177 AATGATAAAGAAAGTATTCAGGG No data
939814216_939814219 -6 Left 939814216 2:146874108-146874130 CCTTGCTCCATCTGTACACTGAG No data
Right 939814219 2:146874125-146874147 ACTGAGTCAGACTCAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939814216 Original CRISPR CTCAGTGTACAGATGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr