ID: 939814325

View in Genome Browser
Species Human (GRCh38)
Location 2:146875080-146875102
Sequence AGGCTGTTGTTCATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939814325_939814328 2 Left 939814325 2:146875080-146875102 CCATGTTTCATGAACAACAGCCT No data
Right 939814328 2:146875105-146875127 GATGGCTGAGTATGCATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939814325 Original CRISPR AGGCTGTTGTTCATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr