ID: 939833115

View in Genome Browser
Species Human (GRCh38)
Location 2:147096258-147096280
Sequence ATGTGATAGATGAACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939833115_939833122 19 Left 939833115 2:147096258-147096280 CCATCACAGTTCATCTATCACAT No data
Right 939833122 2:147096300-147096322 GACTAATAATATCTTTTGAGGGG No data
939833115_939833117 -9 Left 939833115 2:147096258-147096280 CCATCACAGTTCATCTATCACAT No data
Right 939833117 2:147096272-147096294 CTATCACATGCCAAGACCTTGGG No data
939833115_939833121 18 Left 939833115 2:147096258-147096280 CCATCACAGTTCATCTATCACAT No data
Right 939833121 2:147096299-147096321 AGACTAATAATATCTTTTGAGGG No data
939833115_939833120 17 Left 939833115 2:147096258-147096280 CCATCACAGTTCATCTATCACAT No data
Right 939833120 2:147096298-147096320 AAGACTAATAATATCTTTTGAGG No data
939833115_939833116 -10 Left 939833115 2:147096258-147096280 CCATCACAGTTCATCTATCACAT No data
Right 939833116 2:147096271-147096293 TCTATCACATGCCAAGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939833115 Original CRISPR ATGTGATAGATGAACTGTGA TGG (reversed) Intergenic
No off target data available for this crispr