ID: 939837542

View in Genome Browser
Species Human (GRCh38)
Location 2:147149801-147149823
Sequence TTGCTGCGGCTGCTACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939837542_939837546 -3 Left 939837542 2:147149801-147149823 CCTGTCTGTAGCAGCCGCAGCAA No data
Right 939837546 2:147149821-147149843 CAAAAATGCCAGCTGCAGCGGGG No data
939837542_939837545 -4 Left 939837542 2:147149801-147149823 CCTGTCTGTAGCAGCCGCAGCAA No data
Right 939837545 2:147149820-147149842 GCAAAAATGCCAGCTGCAGCGGG No data
939837542_939837544 -5 Left 939837542 2:147149801-147149823 CCTGTCTGTAGCAGCCGCAGCAA No data
Right 939837544 2:147149819-147149841 AGCAAAAATGCCAGCTGCAGCGG No data
939837542_939837549 10 Left 939837542 2:147149801-147149823 CCTGTCTGTAGCAGCCGCAGCAA No data
Right 939837549 2:147149834-147149856 TGCAGCGGGGAGGAGCAGCCTGG No data
939837542_939837547 0 Left 939837542 2:147149801-147149823 CCTGTCTGTAGCAGCCGCAGCAA No data
Right 939837547 2:147149824-147149846 AAATGCCAGCTGCAGCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939837542 Original CRISPR TTGCTGCGGCTGCTACAGAC AGG (reversed) Intergenic
No off target data available for this crispr