ID: 939852386

View in Genome Browser
Species Human (GRCh38)
Location 2:147317485-147317507
Sequence AGGGAGGAGGCAATGATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939852386_939852392 7 Left 939852386 2:147317485-147317507 CCAAAAATCATTGCCTCCTCCCT No data
Right 939852392 2:147317515-147317537 AAACAGTCCAGGTTTTGTAATGG 0: 26
1: 23
2: 19
3: 31
4: 166
939852386_939852394 23 Left 939852386 2:147317485-147317507 CCAAAAATCATTGCCTCCTCCCT No data
Right 939852394 2:147317531-147317553 GTAATGGCAAACATACTCCCTGG No data
939852386_939852390 -4 Left 939852386 2:147317485-147317507 CCAAAAATCATTGCCTCCTCCCT No data
Right 939852390 2:147317504-147317526 CCCTGTTTAACAAACAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939852386 Original CRISPR AGGGAGGAGGCAATGATTTT TGG (reversed) Intergenic
No off target data available for this crispr