ID: 939853604

View in Genome Browser
Species Human (GRCh38)
Location 2:147329980-147330002
Sequence GGCTGCGTTTAGCCCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939853604_939853607 24 Left 939853604 2:147329980-147330002 CCTGTGTAGGGCTAAACGCAGCC No data
Right 939853607 2:147330027-147330049 TAGTTTATTATCTCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939853604 Original CRISPR GGCTGCGTTTAGCCCTACAC AGG (reversed) Intergenic
No off target data available for this crispr