ID: 939864431

View in Genome Browser
Species Human (GRCh38)
Location 2:147456973-147456995
Sequence CAGGCTCAGCATGCTCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939864431_939864439 19 Left 939864431 2:147456973-147456995 CCCCTGAGAGCATGCTGAGCCTG No data
Right 939864439 2:147457015-147457037 ACAGATGATTAGAATGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939864431 Original CRISPR CAGGCTCAGCATGCTCTCAG GGG (reversed) Intergenic
No off target data available for this crispr