ID: 939870525 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:147521315-147521337 |
| Sequence | ATTATTTTGAGTGGCTCCAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939870525_939870530 | 26 | Left | 939870525 | 2:147521315-147521337 | CCTCTGGAGCCACTCAAAATAAT | No data | ||
| Right | 939870530 | 2:147521364-147521386 | AAGTGCCACCCCAAGGATAGAGG | No data | ||||
| 939870525_939870529 | 19 | Left | 939870525 | 2:147521315-147521337 | CCTCTGGAGCCACTCAAAATAAT | No data | ||
| Right | 939870529 | 2:147521357-147521379 | CACATGAAAGTGCCACCCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939870525 | Original CRISPR | ATTATTTTGAGTGGCTCCAG AGG (reversed) | Intergenic | ||