ID: 939870525

View in Genome Browser
Species Human (GRCh38)
Location 2:147521315-147521337
Sequence ATTATTTTGAGTGGCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939870525_939870530 26 Left 939870525 2:147521315-147521337 CCTCTGGAGCCACTCAAAATAAT No data
Right 939870530 2:147521364-147521386 AAGTGCCACCCCAAGGATAGAGG No data
939870525_939870529 19 Left 939870525 2:147521315-147521337 CCTCTGGAGCCACTCAAAATAAT No data
Right 939870529 2:147521357-147521379 CACATGAAAGTGCCACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939870525 Original CRISPR ATTATTTTGAGTGGCTCCAG AGG (reversed) Intergenic