ID: 939870526

View in Genome Browser
Species Human (GRCh38)
Location 2:147521324-147521346
Sequence AATGTGAGAATTATTTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939870526_939870529 10 Left 939870526 2:147521324-147521346 CCACTCAAAATAATTCTCACATT No data
Right 939870529 2:147521357-147521379 CACATGAAAGTGCCACCCCAAGG No data
939870526_939870530 17 Left 939870526 2:147521324-147521346 CCACTCAAAATAATTCTCACATT No data
Right 939870530 2:147521364-147521386 AAGTGCCACCCCAAGGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939870526 Original CRISPR AATGTGAGAATTATTTTGAG TGG (reversed) Intergenic