ID: 939870529

View in Genome Browser
Species Human (GRCh38)
Location 2:147521357-147521379
Sequence CACATGAAAGTGCCACCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939870526_939870529 10 Left 939870526 2:147521324-147521346 CCACTCAAAATAATTCTCACATT No data
Right 939870529 2:147521357-147521379 CACATGAAAGTGCCACCCCAAGG No data
939870525_939870529 19 Left 939870525 2:147521315-147521337 CCTCTGGAGCCACTCAAAATAAT No data
Right 939870529 2:147521357-147521379 CACATGAAAGTGCCACCCCAAGG No data
939870524_939870529 20 Left 939870524 2:147521314-147521336 CCCTCTGGAGCCACTCAAAATAA No data
Right 939870529 2:147521357-147521379 CACATGAAAGTGCCACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939870529 Original CRISPR CACATGAAAGTGCCACCCCA AGG Intergenic