ID: 939870889

View in Genome Browser
Species Human (GRCh38)
Location 2:147524620-147524642
Sequence AAGGGTAGCTAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939870881_939870889 -5 Left 939870881 2:147524602-147524624 CCTGCCATTCCCATCCTTAAGGG No data
Right 939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG No data
939870883_939870889 -9 Left 939870883 2:147524606-147524628 CCATTCCCATCCTTAAGGGTAGC No data
Right 939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939870889 Original CRISPR AAGGGTAGCTAGAAGGAGGA AGG Intergenic
No off target data available for this crispr