ID: 939872803

View in Genome Browser
Species Human (GRCh38)
Location 2:147543536-147543558
Sequence CTTTATACAAAGGATGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939872798_939872803 30 Left 939872798 2:147543483-147543505 CCTATGAAATTTAGAAGGAAAGG No data
Right 939872803 2:147543536-147543558 CTTTATACAAAGGATGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939872803 Original CRISPR CTTTATACAAAGGATGAGTT TGG Intergenic
No off target data available for this crispr