ID: 939873986

View in Genome Browser
Species Human (GRCh38)
Location 2:147555735-147555757
Sequence TTTGAGAAGCCCATTGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939873984_939873986 -9 Left 939873984 2:147555721-147555743 CCCATCTTTCTGCATTTGAGAAG No data
Right 939873986 2:147555735-147555757 TTTGAGAAGCCCATTGATTATGG No data
939873985_939873986 -10 Left 939873985 2:147555722-147555744 CCATCTTTCTGCATTTGAGAAGC No data
Right 939873986 2:147555735-147555757 TTTGAGAAGCCCATTGATTATGG No data
939873982_939873986 6 Left 939873982 2:147555706-147555728 CCTGCCAATCAAGAGCCCATCTT No data
Right 939873986 2:147555735-147555757 TTTGAGAAGCCCATTGATTATGG No data
939873983_939873986 2 Left 939873983 2:147555710-147555732 CCAATCAAGAGCCCATCTTTCTG No data
Right 939873986 2:147555735-147555757 TTTGAGAAGCCCATTGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939873986 Original CRISPR TTTGAGAAGCCCATTGATTA TGG Intergenic
No off target data available for this crispr