ID: 939878936

View in Genome Browser
Species Human (GRCh38)
Location 2:147608287-147608309
Sequence CTTTTCAGTCATTCATAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939878936_939878939 3 Left 939878936 2:147608287-147608309 CCTAACTATGAATGACTGAAAAG No data
Right 939878939 2:147608313-147608335 CAGGAACTGTTGCTACCCCCAGG No data
939878936_939878942 14 Left 939878936 2:147608287-147608309 CCTAACTATGAATGACTGAAAAG No data
Right 939878942 2:147608324-147608346 GCTACCCCCAGGAAGGGCAGAGG No data
939878936_939878941 8 Left 939878936 2:147608287-147608309 CCTAACTATGAATGACTGAAAAG No data
Right 939878941 2:147608318-147608340 ACTGTTGCTACCCCCAGGAAGGG No data
939878936_939878940 7 Left 939878936 2:147608287-147608309 CCTAACTATGAATGACTGAAAAG No data
Right 939878940 2:147608317-147608339 AACTGTTGCTACCCCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939878936 Original CRISPR CTTTTCAGTCATTCATAGTT AGG (reversed) Intergenic
No off target data available for this crispr