ID: 939878939

View in Genome Browser
Species Human (GRCh38)
Location 2:147608313-147608335
Sequence CAGGAACTGTTGCTACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939878936_939878939 3 Left 939878936 2:147608287-147608309 CCTAACTATGAATGACTGAAAAG No data
Right 939878939 2:147608313-147608335 CAGGAACTGTTGCTACCCCCAGG No data
939878935_939878939 4 Left 939878935 2:147608286-147608308 CCCTAACTATGAATGACTGAAAA No data
Right 939878939 2:147608313-147608335 CAGGAACTGTTGCTACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939878939 Original CRISPR CAGGAACTGTTGCTACCCCC AGG Intergenic
No off target data available for this crispr