ID: 939881680

View in Genome Browser
Species Human (GRCh38)
Location 2:147638815-147638837
Sequence CTTATGTAACGTCTTTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939881677_939881680 21 Left 939881677 2:147638771-147638793 CCTCTCACAGGGATGCTGTCAGG No data
Right 939881680 2:147638815-147638837 CTTATGTAACGTCTTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939881680 Original CRISPR CTTATGTAACGTCTTTCTTC TGG Intergenic
No off target data available for this crispr