ID: 939881921

View in Genome Browser
Species Human (GRCh38)
Location 2:147640844-147640866
Sequence CTGGAGGAAGGGTGGGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939881915_939881921 -8 Left 939881915 2:147640829-147640851 CCTGTCTACCAACTACTGGAGGA No data
Right 939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG No data
939881910_939881921 5 Left 939881910 2:147640816-147640838 CCTGATACAAACCCCTGTCTACC No data
Right 939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG No data
939881909_939881921 15 Left 939881909 2:147640806-147640828 CCAAAGGCATCCTGATACAAACC No data
Right 939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG No data
939881912_939881921 -6 Left 939881912 2:147640827-147640849 CCCCTGTCTACCAACTACTGGAG No data
Right 939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG No data
939881908_939881921 16 Left 939881908 2:147640805-147640827 CCCAAAGGCATCCTGATACAAAC No data
Right 939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG No data
939881913_939881921 -7 Left 939881913 2:147640828-147640850 CCCTGTCTACCAACTACTGGAGG No data
Right 939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939881921 Original CRISPR CTGGAGGAAGGGTGGGATGT AGG Intergenic
No off target data available for this crispr