ID: 939882202

View in Genome Browser
Species Human (GRCh38)
Location 2:147643216-147643238
Sequence ATATCCTTCTAGAAGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939882202_939882207 -7 Left 939882202 2:147643216-147643238 CCCCTCCTCTTCTAGAAGGATAT No data
Right 939882207 2:147643232-147643254 AGGATATCAATTATTGGACTTGG No data
939882202_939882209 -5 Left 939882202 2:147643216-147643238 CCCCTCCTCTTCTAGAAGGATAT No data
Right 939882209 2:147643234-147643256 GATATCAATTATTGGACTTGGGG No data
939882202_939882208 -6 Left 939882202 2:147643216-147643238 CCCCTCCTCTTCTAGAAGGATAT No data
Right 939882208 2:147643233-147643255 GGATATCAATTATTGGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939882202 Original CRISPR ATATCCTTCTAGAAGAGGAG GGG (reversed) Intergenic
No off target data available for this crispr