ID: 939887261

View in Genome Browser
Species Human (GRCh38)
Location 2:147694592-147694614
Sequence GACACCTAACACTCTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939887256_939887261 -1 Left 939887256 2:147694570-147694592 CCCTCAATCTACCCACCACATAG No data
Right 939887261 2:147694592-147694614 GACACCTAACACTCTGATTTTGG No data
939887254_939887261 7 Left 939887254 2:147694562-147694584 CCAAAAACCCCTCAATCTACCCA No data
Right 939887261 2:147694592-147694614 GACACCTAACACTCTGATTTTGG No data
939887257_939887261 -2 Left 939887257 2:147694571-147694593 CCTCAATCTACCCACCACATAGA No data
Right 939887261 2:147694592-147694614 GACACCTAACACTCTGATTTTGG No data
939887255_939887261 0 Left 939887255 2:147694569-147694591 CCCCTCAATCTACCCACCACATA No data
Right 939887261 2:147694592-147694614 GACACCTAACACTCTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939887261 Original CRISPR GACACCTAACACTCTGATTT TGG Intergenic
No off target data available for this crispr