ID: 939887658

View in Genome Browser
Species Human (GRCh38)
Location 2:147698711-147698733
Sequence AGATGTACTCTGAAATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939887658_939887659 2 Left 939887658 2:147698711-147698733 CCTACAAATTTCAGAGTACATCT No data
Right 939887659 2:147698736-147698758 TTTTAATTCTCACATCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939887658 Original CRISPR AGATGTACTCTGAAATTTGT AGG (reversed) Intergenic
No off target data available for this crispr