ID: 939892502

View in Genome Browser
Species Human (GRCh38)
Location 2:147754200-147754222
Sequence ATGCATGTTCATTCTGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939892499_939892502 -7 Left 939892499 2:147754184-147754206 CCCAGACTCTGAGGCAATGCATG No data
Right 939892502 2:147754200-147754222 ATGCATGTTCATTCTGAGACGGG No data
939892496_939892502 17 Left 939892496 2:147754160-147754182 CCAAATATCCTCTTCTAGTCATA No data
Right 939892502 2:147754200-147754222 ATGCATGTTCATTCTGAGACGGG No data
939892500_939892502 -8 Left 939892500 2:147754185-147754207 CCAGACTCTGAGGCAATGCATGT No data
Right 939892502 2:147754200-147754222 ATGCATGTTCATTCTGAGACGGG No data
939892497_939892502 9 Left 939892497 2:147754168-147754190 CCTCTTCTAGTCATAACCCAGAC No data
Right 939892502 2:147754200-147754222 ATGCATGTTCATTCTGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939892502 Original CRISPR ATGCATGTTCATTCTGAGAC GGG Intergenic
No off target data available for this crispr