ID: 939902605

View in Genome Browser
Species Human (GRCh38)
Location 2:147868453-147868475
Sequence CAAAGGTTGCCCACTGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939902605_939902608 29 Left 939902605 2:147868453-147868475 CCTGTAGCAGTGGGCAACCTTTG No data
Right 939902608 2:147868505-147868527 AACTCTTGAATTTTGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939902605 Original CRISPR CAAAGGTTGCCCACTGCTAC AGG (reversed) Intronic