ID: 939906235

View in Genome Browser
Species Human (GRCh38)
Location 2:147919422-147919444
Sequence AAGGACCCCCAAAGTTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939906227_939906235 13 Left 939906227 2:147919386-147919408 CCTTGCCCTACCTGGTCACATAG No data
Right 939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG No data
939906224_939906235 30 Left 939906224 2:147919369-147919391 CCTCGTCTTCGATTTTCCCTTGC No data
Right 939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG No data
939906232_939906235 3 Left 939906232 2:147919396-147919418 CCTGGTCACATAGGGAATTAATC No data
Right 939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG No data
939906226_939906235 14 Left 939906226 2:147919385-147919407 CCCTTGCCCTACCTGGTCACATA No data
Right 939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG No data
939906230_939906235 8 Left 939906230 2:147919391-147919413 CCCTACCTGGTCACATAGGGAAT No data
Right 939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG No data
939906231_939906235 7 Left 939906231 2:147919392-147919414 CCTACCTGGTCACATAGGGAATT No data
Right 939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939906235 Original CRISPR AAGGACCCCCAAAGTTATTA AGG Intronic
No off target data available for this crispr