ID: 939906948

View in Genome Browser
Species Human (GRCh38)
Location 2:147928316-147928338
Sequence TCTTTTCACCAAACAGTGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 487}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939906948 Original CRISPR TCTTTTCACCAAACAGTGTG TGG Exonic
901250587 1:7775912-7775934 TCTTTTCAATAAACAGTGCTGGG - Intronic
902662674 1:17916047-17916069 TCATTTCCTAAAACAGTGTGTGG + Intergenic
902724453 1:18325564-18325586 TCTTTTCACCAAACAATGCTGGG - Intronic
903150888 1:21407796-21407818 TCTTTTCAACAAACAGTGCTGGG - Intergenic
903272574 1:22199782-22199804 TCTTTTCAACAAACGGTGCCGGG - Intergenic
904099173 1:28008200-28008222 TCTTTTCAACAAATAGTGCTGGG + Intronic
905712204 1:40115535-40115557 TCTTTTCAACAAATAGTTTTAGG + Intergenic
906062389 1:42957655-42957677 TCTTTTCAACAAATTGTTTGTGG - Intronic
906817931 1:48898535-48898557 TCTTTTCAATAAATGGTGTGGGG - Intronic
907058949 1:51401385-51401407 TCTTTTCAACAAATGGTGTTAGG + Intronic
907370022 1:53995395-53995417 TCTTTTCAACAAATAGTGCTGGG + Intergenic
908462695 1:64361016-64361038 TCTTTCCAACAAATAGTGTTGGG + Intergenic
909907045 1:81209655-81209677 TCTTTTCCCCAAACAGCATTTGG - Intergenic
910180253 1:84474873-84474895 TCTCTTCAATAAACAGTGTTGGG - Intergenic
910904071 1:92154994-92155016 TCTCTTCAACAAACAGTGCTGGG - Intergenic
910925592 1:92395063-92395085 TCTTTTCAACAAATAGTGCTAGG + Exonic
910929314 1:92427162-92427184 TCTTTTCAGCAAATGGTGTCAGG + Intergenic
911072394 1:93842533-93842555 TCTTTTCAGAAAACCGTCTGAGG - Intronic
911081107 1:93932130-93932152 TCTTTTCAACAAATAGTGCTGGG + Intergenic
911600148 1:99839579-99839601 TCTTTTCAACAAATAGTGCTGGG + Intergenic
912119201 1:106449238-106449260 TCTTTTCAACAAATGGTGTTGGG - Intergenic
912541918 1:110423092-110423114 TCTTTTCAACAAATCGTGTTGGG + Intergenic
912663380 1:111555674-111555696 TCTTTTCAACAAATGGTGTTGGG + Intronic
912945837 1:114083385-114083407 TCTTTTTTCCACACAGTTTGGGG - Intergenic
914216341 1:145633468-145633490 TCTTTTCACTAAACGGTGATGGG - Intronic
914234687 1:145798401-145798423 TCTCTTCAGCAAACAGTGTTGGG - Intronic
914468913 1:147956127-147956149 TCTTTTCACTAAACGGTGATGGG - Intronic
914862148 1:151395630-151395652 TCTTTTCAACAAACAGTAGTGGG + Intergenic
915534081 1:156524029-156524051 TCTTTTCAACAAATGGTGTCAGG - Intergenic
917411743 1:174766335-174766357 TCTTTTCAACAAATGGTATGGGG - Intronic
917426126 1:174916153-174916175 TCTTTTCAACAAATAGTGCTGGG - Intronic
917695924 1:177523938-177523960 TCTTTCCCCCAAACATTGTATGG - Intergenic
917822681 1:178780478-178780500 TCTTTTCTCAAAACTGTCTGTGG + Intronic
918224505 1:182468929-182468951 TCTTTTCAACAAACAGTCCTGGG + Intronic
919228860 1:194745898-194745920 TCTTTTCAATAAACAGTGGTGGG - Intergenic
919390034 1:196972202-196972224 TCTTTTCAACAAATTGTGTTGGG + Intergenic
921057742 1:211556707-211556729 TCTTTTCAACAAATAGTTTTGGG + Intergenic
921120838 1:212135605-212135627 ACTTTTCAGCAAAAGGTGTGTGG + Intergenic
922448099 1:225714418-225714440 TCTTTTCAACAAATGGTGTGGGG - Intergenic
924066428 1:240227706-240227728 TCTTTTCAACAAATGGTGTTGGG + Intronic
924632784 1:245757657-245757679 TCTCTTCAACAAATAGTGTTGGG - Intronic
924855149 1:247868435-247868457 TCTGGTCACCAAAATGTGTGGGG + Intronic
1062847066 10:715854-715876 TTTTTTCAACAGACAGTGTTGGG - Intergenic
1063364991 10:5485241-5485263 TCTTTTCAGCACCCAGCGTGTGG + Intergenic
1064795998 10:19011769-19011791 TCTTTTCAACAAACGGTGTTGGG - Intergenic
1065335396 10:24652254-24652276 ACTTTCCACAAAATAGTGTGGGG + Intronic
1066118750 10:32263370-32263392 TTTTTTCCCCAAACCCTGTGTGG + Intergenic
1067220167 10:44338168-44338190 TCTATTCACTGATCAGTGTGTGG - Intergenic
1067330777 10:45316455-45316477 TCTCTTCAACAAACAGTGTTGGG + Intergenic
1068513694 10:57998961-57998983 TATTTTCCACAAACAGTGTGAGG - Intergenic
1068583754 10:58773307-58773329 TCTTTTAACGAGAAAGTGTGTGG - Intronic
1071084411 10:81851567-81851589 TCTTTTCAACAAATGGTGTTAGG - Intergenic
1071165964 10:82807019-82807041 TCTTGGCAGCAAACAATGTGTGG - Intronic
1071242304 10:83721246-83721268 TCTTTTCAACAAATGGTGTTGGG + Intergenic
1071440939 10:85693693-85693715 ACTTTTCAATAAATAGTGTGGGG + Intronic
1072073009 10:91938498-91938520 TCTTTTCAACAAACGGTGGTGGG - Intronic
1072572095 10:96667229-96667251 TCTTTTCACTATACAATGTCTGG + Intronic
1072940495 10:99759567-99759589 TCTTTTTAGCAATCAGTCTGGGG + Intergenic
1073885119 10:108029794-108029816 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1075906659 10:126087513-126087535 TTTTTTCACCTAACACTTTGAGG + Intronic
1076928992 10:133515234-133515256 TCTTTTCAACAAACAGTGCTGGG + Intergenic
1077461095 11:2710709-2710731 TCTTTTCAACAAATGGTGTTGGG - Intronic
1077765741 11:5158244-5158266 TCTTTTCAAGAAACAGTGCTAGG - Intronic
1078218164 11:9329299-9329321 GCCTTTCCCCAAACAGTTTGGGG - Intergenic
1078334355 11:10451658-10451680 TCATTTCCCCAAACTGTATGTGG + Intronic
1080302211 11:30797339-30797361 TCTCTGCCCCAAAAAGTGTGTGG + Intergenic
1080383713 11:31798484-31798506 TCTTAGCACCAAAAAGTCTGAGG + Intronic
1080389547 11:31832161-31832183 TCCTTTCATCTAACAGTCTGAGG + Intronic
1081735287 11:45399195-45399217 TCTGCTCACCAAAATGTGTGTGG + Intergenic
1081816977 11:45951647-45951669 TCTTTTGATGAAGCAGTGTGTGG + Intronic
1082295508 11:50437436-50437458 TCTTTTCAATAAGCAGTTTGGGG + Intergenic
1083117070 11:60471849-60471871 TCTTTTCAACAAACTGTGGTGGG + Intergenic
1083556735 11:63635277-63635299 TCTTTTCACCAAACACACTTTGG - Intronic
1084281939 11:68102460-68102482 TCTCTTCAATAAACAGTGTTGGG + Intronic
1089181220 11:116584142-116584164 TCTTCTCGCCAACCTGTGTGTGG - Intergenic
1089870868 11:121671681-121671703 TGTATTCCCCAAACGGTGTGTGG + Intergenic
1090222713 11:125043850-125043872 CTTTTTCAACAAACAGTGTTGGG - Intergenic
1090865013 11:130692083-130692105 TCTTTTAACCTAACGGTGTGTGG - Intronic
1091935989 12:4434908-4434930 TCTTTTCTGCAGACTGTGTGTGG + Intronic
1093251881 12:16815776-16815798 TCTTTTCAACAAATGGTGTTGGG + Intergenic
1093438586 12:19166145-19166167 TTTTTTCAATAAACTGTGTGTGG + Intronic
1095043933 12:37477797-37477819 TGTTTAAACCAAACAGTCTGTGG + Intergenic
1095210710 12:39491014-39491036 TGATTTCACCAAACAAGGTGGGG + Intergenic
1095805604 12:46316388-46316410 TCTTTTCAACAAATGGTGTTGGG + Intergenic
1095879617 12:47119144-47119166 TCTTTTCAACAAATAGTGCTGGG + Intronic
1096168217 12:49443717-49443739 TCTTTTCAACAAATAGTATTGGG - Intronic
1096435568 12:51588528-51588550 TGTTTTCAACAAATAGTATGGGG + Intergenic
1097422579 12:59398652-59398674 TGGTCTCACAAAACAGTGTGGGG - Intergenic
1099360362 12:81693358-81693380 TCTGCTCATCAAAGAGTGTGTGG + Intronic
1099432778 12:82607892-82607914 TCCTTTCTACAAACAGTTTGAGG + Intergenic
1100413751 12:94350396-94350418 TGTTGTCAACAAACAGTGTTGGG + Intronic
1100424224 12:94468168-94468190 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1101467794 12:104965577-104965599 TCCTTAAACCAAACAGTGTAGGG - Intergenic
1101630732 12:106491517-106491539 TCATTTCACCATTCAGTGTAAGG + Intronic
1102314930 12:111879927-111879949 ACTTTTCAAGGAACAGTGTGGGG + Intronic
1105404639 13:20123239-20123261 TCTTTTCAACAAATAGTGTTAGG - Intergenic
1105903803 13:24783125-24783147 TCTTTTCAACAAATAGTGCTGGG - Intronic
1106139114 13:26996524-26996546 TCTTTTCAACAAACTGTGCTGGG - Intergenic
1106768776 13:32941807-32941829 TCTTTTCAGCAAATGGTGTTGGG + Intergenic
1106806906 13:33318341-33318363 TCTTTTCAGCAAACGGTTTTGGG + Intronic
1108103250 13:46980903-46980925 TCTCTTCAACAAATAGTGTTGGG + Intergenic
1108744760 13:53381082-53381104 TCTCTTCAACAAAGAGTGTTGGG - Intergenic
1109317598 13:60768865-60768887 ACATTTCAACCAACAGTGTGTGG + Intergenic
1109382192 13:61577444-61577466 TCTATTCACTAAATAGTGTTGGG + Intergenic
1109701337 13:66028493-66028515 TCTTTTCAACAAAGAGTGCTGGG - Intergenic
1110508574 13:76320846-76320868 TCTCTTCAATAAACAGTGTAGGG - Intergenic
1111139059 13:84090323-84090345 TGTTTTCACCAATAAGTGTCAGG + Intergenic
1111730407 13:92069096-92069118 TCTTATCAACAAATAGTGTTGGG - Intronic
1112154013 13:96797764-96797786 TGTAGTCACCAAGCAGTGTGTGG + Intronic
1112789759 13:102989984-102990006 TCTTTTCAACAAATAGTGCTGGG - Intergenic
1113356101 13:109581694-109581716 TCTTTACACCTAACACAGTGTGG - Intergenic
1114357780 14:21931686-21931708 TCTTTTCAACAAACAGTGTTGGG - Intergenic
1114888492 14:26885895-26885917 TCTTTTCAACAAATGGTGTCGGG - Intergenic
1115628304 14:35217674-35217696 TCTTTTCAACAAATAGTGCCAGG - Intronic
1115896788 14:38098032-38098054 TCTTTTCAATAAACTGTGTTGGG + Intergenic
1115990832 14:39147695-39147717 TCTCTTCAACAAATAGTGTTGGG - Intergenic
1116172386 14:41419973-41419995 TATTTTCAACAAGCAGTCTGTGG + Intergenic
1116392473 14:44409294-44409316 TTTTTTCATCCTACAGTGTGTGG - Intergenic
1117210979 14:53499466-53499488 TCTTTTCAACAAACAGTGTTGGG + Intergenic
1117360981 14:54973531-54973553 AGTTTTCACCACACAGTATGAGG + Intronic
1117381106 14:55164406-55164428 TCTTTTCAACAAACAGTGCTGGG + Intronic
1117709918 14:58516902-58516924 TCTTTTCAACAAATGGTGTTTGG + Intronic
1117762497 14:59045301-59045323 TCTTTTCAGCAATCAGTGTTGGG - Intergenic
1119354242 14:73992143-73992165 ACTTTGCACCAAACAGTTTTGGG + Intronic
1119501126 14:75128002-75128024 TCCTGTTCCCAAACAGTGTGTGG - Intergenic
1119726452 14:76924541-76924563 TCTTTCCACCAAAAACTGTTTGG - Intergenic
1120634709 14:86937424-86937446 CCCTCTCCCCAAACAGTGTGTGG + Intergenic
1121066553 14:90972515-90972537 ACTTTTAACTAAACAGTGTTGGG + Intronic
1121519074 14:94573465-94573487 TCTGGTCACCAAAATGTGTGTGG + Intronic
1122185653 14:99992659-99992681 ACTTTTCAACAAACAGTGTTAGG - Intronic
1122240109 14:100358440-100358462 TCTTTTCAAAAAACAGTGCTGGG + Intronic
1122450451 14:101802070-101802092 TCTTTTCAACAAATGGTGTTGGG + Intronic
1122728157 14:103774051-103774073 TCTTTTCACCAAATGGTGCTGGG + Intronic
1123169034 14:106354063-106354085 TCTTTTGACCATAATGTGTGAGG + Intergenic
1123669018 15:22635762-22635784 TCTTGTCAACAAATAGTGTTGGG - Intergenic
1123708757 15:22970700-22970722 TCTTTTCAACAAATTGTGTTAGG + Intronic
1123803631 15:23849343-23849365 TCTCTTCAACAAACAGTGTTAGG - Intergenic
1124134732 15:27024535-27024557 TCTTTTCAACCAACAGTGCTAGG - Intronic
1124381122 15:29167077-29167099 TCTTTTCAACAAATGGTGTTGGG + Intronic
1124524988 15:30442255-30442277 TCTTGTCAACAAATAGTGTTGGG - Intergenic
1124773665 15:32565458-32565480 TCTTGTCAACAAATAGTGTTGGG + Intergenic
1125704457 15:41720920-41720942 TCTTTTCACCAAATGGTGATAGG + Intronic
1125762829 15:42109317-42109339 TCTTTGCAACAAAAAGGGTGGGG + Intergenic
1125928234 15:43581110-43581132 TCCTTGCAGCAAACAGTTTGTGG - Exonic
1125941399 15:43680945-43680967 TCCTTGCAGCAAACAGTTTGTGG - Intergenic
1126647323 15:50887961-50887983 TCTTTTCAACAAATAGTATTGGG - Intergenic
1126855290 15:52832901-52832923 TCTTTTCACCTGAGAGGGTGAGG + Intergenic
1128381030 15:67112873-67112895 TCTTCTCAACAAACAGTGCATGG - Intronic
1128627101 15:69220991-69221013 TCTTTTCAACAAATGGTGTTGGG - Intronic
1131569012 15:93514063-93514085 TCTTTTCAACAAATGGTGTTTGG + Intergenic
1131734900 15:95321671-95321693 TCTTTTCAACAAATAGTGTTGGG - Intergenic
1132108227 15:99081255-99081277 TCTTTTCAATAAACAGTGCTGGG + Intergenic
1132364426 15:101246673-101246695 TTTTTTCCCCAAATAGTATGTGG - Intronic
1135409612 16:22223584-22223606 TCTTTTCAACAAATGGTGTTGGG - Intronic
1135583318 16:23646946-23646968 TATTTTCAACAAACAGTGCCAGG - Intronic
1135659266 16:24280467-24280489 TTTCATCCCCAAACAGTGTGTGG - Intronic
1136601589 16:31294955-31294977 TCTCTTCAACAAATGGTGTGGGG - Intronic
1137517008 16:49154406-49154428 TCTCTTCAATAAATAGTGTGAGG + Intergenic
1137659052 16:50187639-50187661 TCTTTTCAACAAATAGTGATGGG - Intronic
1138256225 16:55564603-55564625 TCTTTTCAACAAATAGTGCTGGG + Intronic
1138871586 16:60894439-60894461 TCTCTTCAACAAACAGTGTTGGG - Intergenic
1139370318 16:66463858-66463880 TCTTTTCAACAAATGGTGTTAGG - Intronic
1142619436 17:1155317-1155339 TCTTTTCACCAAATGGTGCTGGG + Intronic
1143246944 17:5494757-5494779 TCTTCTCAACAGACAGTGTTGGG + Intergenic
1143758112 17:9081238-9081260 TCTGGTCACCAAGAAGTGTGAGG - Intronic
1145108363 17:20139307-20139329 CATTTTCAGCAAACAGTGGGAGG - Intronic
1145220077 17:21081162-21081184 TCTCTTCAACAAATGGTGTGGGG + Intergenic
1147227517 17:38991108-38991130 TCTTTTCAACAAATGGTGTTGGG - Intergenic
1149201873 17:54196141-54196163 ACTTTTCACCAAGCAGGGTGAGG - Intergenic
1149226798 17:54481016-54481038 TTTACTCACCAAACTGTGTGAGG - Intergenic
1149269105 17:54957067-54957089 TTTTTTCCCCAAACCCTGTGTGG - Intronic
1149410559 17:56401618-56401640 TATTTTCAGCAAACAGTGACAGG + Intronic
1149739066 17:59026175-59026197 TCTTTTCAACAAATAGTGCTGGG + Intronic
1149942748 17:60887585-60887607 TCTTTTCAACAAACGGTGCTGGG - Intronic
1151095998 17:71498797-71498819 TCTCTTCAATAAACAGTGTTGGG + Intergenic
1151256210 17:72878728-72878750 TCTGGTCACCAAACTGTATGGGG + Intronic
1152014336 17:77740235-77740257 TCTTTTCAACAAACAGTGCTGGG - Intergenic
1152726180 17:81947513-81947535 TCTGGTCACCAAAATGTGTGTGG - Intergenic
1203168731 17_GL000205v2_random:125872-125894 TCTCTTCAACAAACAGTATTGGG + Intergenic
1153264274 18:3253962-3253984 ACTTCTCACCAAACATGGTGAGG - Exonic
1153750587 18:8226083-8226105 TCTTTTCACCCATCAGATTGAGG + Intronic
1153922209 18:9801912-9801934 TCTTTTCAATAAACTGTGTTGGG - Intronic
1154040320 18:10848602-10848624 GCTTTTCACCTTACATTGTGAGG - Intronic
1154235804 18:12604388-12604410 TCTGCTCACCAAGAAGTGTGTGG - Intronic
1155260338 18:24036009-24036031 TCTTTTCAACAAACAGTGCTGGG - Intronic
1155672271 18:28386536-28386558 TCTTTTCAACAAATAGTGATGGG + Intergenic
1155871414 18:31033504-31033526 TCTTTTCAACAAATGGTGTTGGG + Intronic
1156256741 18:35405233-35405255 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1156342564 18:36223322-36223344 TCTTTTCAACAAATGGTGTTGGG - Intronic
1157320924 18:46633382-46633404 TCTTTTCAACAAATAGTGCTGGG + Intronic
1158554489 18:58464160-58464182 TTTTTTCTGCAAACAGTGAGTGG + Intergenic
1158587172 18:58750640-58750662 TCTTTTCAACAAACGGTGCTGGG + Intergenic
1159701066 18:71628334-71628356 TCTTTTCAAAAACTAGTGTGGGG + Intergenic
1160219400 18:76962289-76962311 CCTTTTCAACAAACAGTGCTGGG - Intronic
1161071583 19:2264614-2264636 TCTTTTGAGCAAACAGTGTGGGG - Intronic
1163813614 19:19450181-19450203 TCCCATCACCAAACAGTGGGCGG - Intronic
1166128768 19:40732937-40732959 TCTTTTCAATAAACAGTGCTGGG - Intronic
1167461273 19:49625809-49625831 TCTGTACACCGAACAGTGGGAGG - Exonic
1167869429 19:52355467-52355489 TCTGGTCACCAAAATGTGTGGGG + Intronic
1167971621 19:53191233-53191255 TCTCATCACCAAAACGTGTGGGG - Intronic
1168192123 19:54746625-54746647 TCTTTTCAATAAACAGTGCAGGG - Intronic
1168194401 19:54763181-54763203 TCTTTTCAATAAACAGTGCAGGG - Intronic
1168196453 19:54777903-54777925 TCTTTTCAATAAACAGTGCAGGG - Intronic
1168202224 19:54824319-54824341 TCTTTTCAATAAATGGTGTGGGG - Intronic
925280979 2:2684240-2684262 TCTTTTCAACAATCAATGTTTGG + Intergenic
925294954 2:2770092-2770114 GCTTGTCACCAGACAGTTTGTGG - Intergenic
925468467 2:4133467-4133489 GCTCTGCTCCAAACAGTGTGAGG - Intergenic
927403164 2:22737409-22737431 TCTCTTCAACAGACAGTGTTGGG + Intergenic
928287313 2:30003834-30003856 TCTTTTCAACAAATGGTGTTGGG + Intergenic
928407740 2:31027719-31027741 CCATTTCACCATACAGGGTGGGG - Intronic
928978154 2:37110464-37110486 GTTTTTAACCAAATAGTGTGAGG + Intronic
929097476 2:38277774-38277796 TCTTTTCCCCACAAAGTGAGAGG - Intergenic
929834040 2:45377984-45378006 TCTTTTCAACAAAGAATGTAGGG + Intergenic
930681117 2:54257342-54257364 TCTTTTCAATAAACAGTGCTGGG - Intronic
930731495 2:54732526-54732548 TCTTTTCAACAAACGATGTTGGG - Intronic
931065394 2:58580523-58580545 TCTTTTAACAAAATAGTGTAAGG + Intergenic
931326083 2:61225071-61225093 TCTTTTCAGAAAACAGTGGTAGG + Intronic
931373672 2:61688231-61688253 TCTTTTCAACAAATAGTGCTGGG + Intergenic
932308394 2:70720115-70720137 TCTTATGCCCAAACAGTGGGGGG - Intronic
932382106 2:71294082-71294104 TCTTTTCAACAAACGGTGTTGGG - Intronic
932622316 2:73272100-73272122 TCTGTTCACCAACCTGTGAGTGG - Intronic
934953569 2:98596800-98596822 TCTTTTCAACAAATGGTGTTGGG + Intergenic
935436646 2:103042755-103042777 TCTTTTCAGCAAACAGTGCTGGG + Intergenic
935533668 2:104266707-104266729 TCTCTTCAACAAACAGTGTTGGG + Intergenic
936272312 2:111058381-111058403 ACTTTTCAGCACACAGTGAGGGG + Intronic
936685875 2:114825970-114825992 TCTTTTTGCCAAAAAGAGTGGGG + Intronic
937444186 2:121942958-121942980 TCTGGTCACCAAAATGTGTGTGG + Intergenic
937794293 2:125998711-125998733 TCTCTTCTCCAAACACTGTCAGG - Intergenic
937891734 2:126944309-126944331 GTTTTTCCCCAAACAGTATGTGG - Intergenic
938404130 2:131018822-131018844 TCTTTACAGCGAACAGTGTTGGG - Intronic
938722858 2:134081613-134081635 CCTTTTCACCAAAAAGTGGCAGG - Intergenic
939767378 2:146267567-146267589 ACTTTTCACCAATTAATGTGAGG - Intergenic
939813444 2:146864678-146864700 CCTTTTCAACAAACAGTCTTGGG + Intergenic
939906948 2:147928316-147928338 TCTTTTCACCAAACAGTGTGTGG + Exonic
940425149 2:153523088-153523110 TCTTTTCAACAAATGGTGTTTGG - Intergenic
940660817 2:156543125-156543147 TGTTTTCACCAAAGATTTTGTGG + Intronic
941308919 2:163905963-163905985 TCTTTTCAACAAATGGTGTTGGG + Intergenic
941532343 2:166685961-166685983 TTTCTTCAGCAAACAGTCTGTGG - Intergenic
941589126 2:167396822-167396844 TCCTTTCCCTAAACTGTGTGAGG - Intergenic
941876614 2:170440089-170440111 TCTCTTCAACAAACAGTGTTAGG - Intronic
942336577 2:174893884-174893906 TCTCTTCAACAAACAGTGTTGGG + Intronic
942815051 2:180042971-180042993 TCTGGTCACCAAAGTGTGTGTGG - Intergenic
942881397 2:180865508-180865530 TCTCTTCAACAAATAGTGTTGGG - Intergenic
943074976 2:183183370-183183392 TCTCTTCAACAAATAGTGTTGGG - Intergenic
943123818 2:183771781-183771803 TCTTTTCAACACATTGTGTGGGG + Intergenic
943311758 2:186334235-186334257 TCTGGTCACCAAGAAGTGTGGGG - Intergenic
943682078 2:190778716-190778738 TCTTTTCAGCAAATGGTGTTGGG - Intergenic
943822401 2:192342420-192342442 TCTTTTAAACAAACAGTGCTTGG - Intergenic
944165535 2:196715621-196715643 TCTTTTCAACAAACGGTGCCGGG + Intronic
944196175 2:197055663-197055685 TCTTTTCACCAAATAGTGCTAGG - Intronic
944623395 2:201543084-201543106 TCTTTTCAGCAAATGGTGTTGGG - Intronic
944992182 2:205250592-205250614 TTTTTTCATCAAACTGTGTTAGG - Intronic
945092550 2:206189235-206189257 TCTTTTTACCAGAGTGTGTGAGG - Intronic
945823418 2:214691893-214691915 TCTTTTCAACAAATAGTGCTGGG + Intergenic
946765961 2:223041071-223041093 TCTTTTCAACAAATGGTGTGGGG + Intergenic
946799089 2:223390714-223390736 TCTTGTCACTTAAAAGTGTGTGG - Intergenic
946956261 2:224933091-224933113 TCTTTTCTCCAAACATTGTGTGG - Intronic
947125921 2:226868305-226868327 ACTTATCAACAAACAGTTTGTGG + Intronic
947272268 2:228349459-228349481 TCTTTTCAATAAACAGTGTAAGG - Intergenic
947553579 2:231066919-231066941 TCACTACACCAAACAATGTGTGG + Exonic
1168909105 20:1431853-1431875 TCTCTTCAACAAACAGTGCCGGG - Intergenic
1169031633 20:2413596-2413618 TCTTTTCAACAAATGGTGTTGGG + Intronic
1169303277 20:4465432-4465454 TTTTTCAACCAAACAGTTTGAGG - Intergenic
1171028942 20:21658804-21658826 TGTTTTCAACAAACAGTGCTGGG + Intergenic
1171177458 20:23063260-23063282 TCTTTGCAGAAAACAGTATGAGG - Intergenic
1171188552 20:23141647-23141669 TCTGTTCTCAAAACACTGTGAGG - Intergenic
1173120532 20:40285177-40285199 TCTAGTCCCCAAACAGGGTGTGG + Intergenic
1173230029 20:41187508-41187530 TCTTTTCACCAAAAGGTGCTGGG - Intronic
1174265301 20:49327190-49327212 TCATTTTACCAAAGAGTGTTAGG + Intergenic
1174341305 20:49897984-49898006 TCTCTTCACCAGATAGTGTTGGG + Intergenic
1174516242 20:51094500-51094522 TCTTTGCAACAAACCCTGTGTGG - Intergenic
1175091567 20:56508781-56508803 TTTTTTCAACAAATAGTGTGGGG + Intronic
1175607717 20:60324556-60324578 CCTTTTCACTTAACAATGTGAGG - Intergenic
1176403030 21:6333267-6333289 TCTCTTCAACAAACAGTATTGGG - Intergenic
1176434127 21:6655837-6655859 TCTCTTCAACAAACAGTATTGGG + Intergenic
1176703411 21:10087669-10087691 TATTTTCACAAATCAGTCTGAGG + Intergenic
1176907154 21:14515407-14515429 TCTTTTCAACAAATAGTGTAAGG + Intronic
1177597244 21:23261078-23261100 TCTTTTCAACAAACGGTGATGGG + Intergenic
1177894992 21:26846528-26846550 TCTTCTCTCCAAAAAGTGGGAGG + Intergenic
1177995013 21:28086359-28086381 CCTTTTCAACAAACGGTGCGGGG - Intergenic
1178388106 21:32172864-32172886 TCTTTTCAACAAATGGTGTTGGG + Intergenic
1178660281 21:34501971-34501993 TGTTGTCACCAACCAGTGGGTGG + Intergenic
1178986400 21:37307311-37307333 TTTTTTCAACAAACAGTGCTGGG - Intergenic
1180251147 21:46590187-46590209 CCTTTTCAACAAATGGTGTGGGG + Intergenic
1181634858 22:24169814-24169836 TCTTCTCACGCTACAGTGTGGGG - Intronic
949175395 3:1055832-1055854 CCTTTTATCCAAACAGTGTCTGG + Intergenic
951166719 3:19490936-19490958 TCATTTCAGCAGACAGTCTGTGG + Intronic
951520035 3:23602861-23602883 TCTCTTTAGCAAACAGTTTGAGG + Intergenic
951760414 3:26141310-26141332 TTTGTTTACAAAACAGTGTGGGG - Intergenic
952129809 3:30348072-30348094 ACTCTTCACCAAACACTTTGTGG - Intergenic
952251350 3:31658842-31658864 TCTTTTCAACAAATGGTGTTGGG + Exonic
952314886 3:32223981-32224003 GCTTTTCAGCAAACAGTGACTGG - Intergenic
952419159 3:33115567-33115589 TCTTTTAGCCAAACCCTGTGAGG - Intronic
952566676 3:34667701-34667723 TCTTTTCAACAAATAGTGCTGGG - Intergenic
953037108 3:39222132-39222154 TCTTTTCAACAAATGGTGTTGGG + Intergenic
953522217 3:43654613-43654635 GCTTTTCACCAAACTGGGTTTGG - Intronic
953918235 3:46934360-46934382 TCTTTTCCCCACACAGGGAGGGG + Intronic
954287935 3:49632084-49632106 TCTTTTCAACAAATGGTGTTGGG + Intronic
954932033 3:54292077-54292099 TCTTTTCAACAAATGGTGTGGGG + Intronic
955251243 3:57284759-57284781 TCTTTTCACTATACAGTGCTAGG + Intronic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
956208837 3:66782480-66782502 TCTTTTCAATAAACAGTGTTGGG - Intergenic
956485919 3:69721899-69721921 TCTGGTCACCAAGAAGTGTGTGG - Intergenic
956926764 3:73997407-73997429 TCTTTTCAACAAAGAGTATTGGG + Intergenic
957335260 3:78819502-78819524 TCTTTTCACTAAAAAGTATTAGG - Intronic
957410132 3:79829883-79829905 TCTTTTCAACAAAAAGTGTGGGG + Intergenic
957656017 3:83076469-83076491 TCTTTTCAATAAACAGTGCTTGG + Intergenic
959218718 3:103486263-103486285 TTTTTTCAACAAATTGTGTGTGG + Intergenic
960243035 3:115367779-115367801 ACTTTTCAACAACAAGTGTGAGG - Intergenic
960857318 3:122115941-122115963 TATTTTCAACAAATAGTGTTGGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961418412 3:126779681-126779703 TCTTTTCAACAAATAGTGCTGGG - Intronic
961923954 3:130456308-130456330 TATTTTCATTAAAAAGTGTGAGG + Intronic
961966315 3:130907501-130907523 TCTTTTTAACAAACAGTATTGGG - Intronic
962555576 3:136547955-136547977 TCTTTTCAACAAATGGTGTTTGG - Intronic
963154918 3:142086241-142086263 TCTGGTCACCAAAATGTGTGGGG + Intronic
963180042 3:142345306-142345328 TCTTTTTAACAAACAATGTTTGG + Intronic
963739626 3:149063898-149063920 TCTTTTTACTAAACACTGTTCGG + Intronic
964204692 3:154160251-154160273 TCTTATCAACAACCAGTGTCTGG + Intronic
964693313 3:159478312-159478334 TCTTTTCAACAAATGGTGTTGGG - Intronic
965022838 3:163256732-163256754 TCTTTTGAACAAACAGTGACAGG + Intergenic
965232238 3:166069453-166069475 TCTTTTCAACAAGCAGTGTTTGG - Intergenic
965430945 3:168587724-168587746 TCTTTTCAATAAACAGTGTTGGG - Intergenic
965754597 3:172012743-172012765 TCTGGTCACCAAAATGTGTGAGG - Intergenic
965754889 3:172015615-172015637 TCTGGTCACCAAAATGTGTGGGG - Intergenic
965898830 3:173614118-173614140 TCTTTTCTCCAAAAGGTTTGGGG + Intronic
965904682 3:173689292-173689314 TCTTGTCACAAGACTGTGTGAGG + Intronic
965956213 3:174373071-174373093 TCTTTTTAATAAACAGTGTTGGG + Intergenic
966587057 3:181638108-181638130 TCTTTTAACCACCCAGTTTGTGG - Intergenic
967232047 3:187348642-187348664 TCTCTTCAATAAACAGTGTTGGG - Intergenic
967662661 3:192132217-192132239 TTTTTTCCCTAAATAGTGTGTGG + Intergenic
968851292 4:3080823-3080845 TCTCTTCAACAAACAGTGCTGGG - Intronic
969240122 4:5892213-5892235 TCTTTTCACAAAACAGAATGAGG + Intronic
969500679 4:7550767-7550789 TCATTTTACCAAACAAAGTGGGG + Intronic
970369684 4:15394421-15394443 TCTTTTCACTAAACAATATGTGG - Intronic
970459219 4:16256205-16256227 TCTTTTCATCCCACAGAGTGAGG - Intergenic
970548899 4:17159146-17159168 TCTTTTCAACAAATAGTGCTGGG - Intergenic
970694234 4:18657671-18657693 TATTTTCCTAAAACAGTGTGAGG + Intergenic
971623047 4:28881917-28881939 ACTTTTCACAAAACAGTCTTAGG - Intergenic
972694416 4:41431252-41431274 TCTTTCCACCAAGCAGGGGGAGG - Intronic
973025790 4:45268795-45268817 TCTTTTTAACAAATAGTGTTGGG - Intergenic
973112752 4:46415496-46415518 GTTTTTCCCCAAACCGTGTGTGG - Intronic
973217370 4:47684674-47684696 TCTTTTCAACAAACGGTATTGGG + Intronic
973701072 4:53537873-53537895 TCCTTTCAGGAAACGGTGTGGGG + Intronic
973906164 4:55533376-55533398 TCTCTACAACAAACAGTGTTGGG + Intronic
974151236 4:58012184-58012206 TCTTTTCAATAAATAGTGTTTGG + Intergenic
974903162 4:68025767-68025789 TATTTTCACCAAAGAGTTTTAGG - Intergenic
974910892 4:68118213-68118235 TGTTAACACCAACCAGTGTGAGG + Intronic
975608760 4:76183202-76183224 TCTGGTCACCAAGAAGTGTGTGG + Intronic
976329723 4:83815443-83815465 TCTTTTCATCAAACCCTGTGAGG - Intergenic
976336926 4:83899484-83899506 ACTTTCCACCACACAGTTTGTGG + Intergenic
976535805 4:86215169-86215191 TCTTTTCAACAAACAGTACTGGG + Intronic
978068537 4:104437025-104437047 TCTTATCACCAGACTTTGTGTGG + Intergenic
978377976 4:108095475-108095497 GCTGAGCACCAAACAGTGTGGGG - Intronic
979059345 4:116036890-116036912 TCTTTTCAACAAATAGTGCTGGG + Intergenic
979912833 4:126391430-126391452 TCTTTTCAACAAATAGTGCTGGG - Intergenic
980375632 4:131944034-131944056 TATTTTCACAAATCAGTCTGAGG + Intergenic
980954387 4:139413669-139413691 TCTTTTCAATAAATGGTGTGGGG - Intronic
982361343 4:154522859-154522881 TCTTTTCAACAAATGGTGTTGGG + Intergenic
983174843 4:164576423-164576445 TCTGGTCACCATAGAGTGTGGGG - Intergenic
984291789 4:177805516-177805538 TCTTTTCAACAAATGGTGTTGGG + Intronic
984337566 4:178412694-178412716 TCTTTTCAGCAAATAGTGTTAGG + Intergenic
985203928 4:187513255-187513277 TCTGTTCTCAACACAGTGTGTGG - Intergenic
987203112 5:15597234-15597256 TCTGGTCACCAAAATGTGTGCGG - Intronic
987842637 5:23240317-23240339 TGTATTCTCCAAACAGAGTGTGG - Intergenic
988228437 5:28444894-28444916 TCTTTTCAACAAATATTGTTGGG - Intergenic
988955775 5:36316861-36316883 TCTCTTCAACAAACAGTGTTGGG - Intergenic
989409221 5:41098343-41098365 TCATGTCACCAAACAATGTTAGG - Intergenic
989457108 5:41657201-41657223 TCTGGTCACCAAATTGTGTGAGG + Intergenic
991268703 5:64753143-64753165 TCTTTTAACCTAACACTTTGAGG - Intronic
991541565 5:67735319-67735341 TCTCTTCAACAAATAGTGTTGGG + Intergenic
992217768 5:74542750-74542772 TCTTTACAGAAAACAGGGTGGGG + Intergenic
992378144 5:76210141-76210163 TCTGGTCACCAAAATGTGTGGGG + Intronic
992588126 5:78262462-78262484 TCTTTTCAACAAATAATGTTGGG - Intronic
993425463 5:87758537-87758559 TCTTTTCAGTAAATAGTGTTGGG - Intergenic
993675164 5:90807914-90807936 TCTTTAGAGCAAACAGTGGGTGG - Intronic
993914307 5:93723630-93723652 TATTTTCAACAAACAGTGGCTGG + Intronic
994013588 5:94938235-94938257 TCTTTCCCCAAAACACTGTGGGG - Intronic
995149321 5:108824009-108824031 TCTCTTCAATAAACAGTGTTGGG - Intronic
996246816 5:121274068-121274090 GTTTTTCCCCAAACACTGTGTGG + Intergenic
997115739 5:131124039-131124061 TCTTCTGAGCAAACAGTATGGGG - Intergenic
997796029 5:136812220-136812242 TCTTTTCAACAAATAGTGCTGGG + Intergenic
997881135 5:137591372-137591394 TATTTTCAACAAATAGTGTTGGG + Intronic
998901106 5:146855817-146855839 TCATTTCTCGATACAGTGTGTGG - Intronic
999215087 5:149926397-149926419 TCTTTTCAATAAACAGTGCTGGG + Intronic
999562311 5:152817959-152817981 ACTTTTCACCAACCAGTTTTTGG + Intergenic
1000576495 5:162981682-162981704 TTTTTTAACCAAACAGTGAGGGG - Intergenic
1000592814 5:163179070-163179092 CCTTTTCACCAAATGGTGTTGGG - Intergenic
1000803950 5:165765312-165765334 TCTTTTCAACAAACTGTGCTGGG + Intergenic
1000873277 5:166604107-166604129 TCTTTTCAACAAACAGTGCTGGG - Intergenic
1001800394 5:174538513-174538535 TCTTTTCAACAAACGGTGCTGGG + Intergenic
1003598043 6:7492548-7492570 TCTTTTCAACAAATAGTGCTGGG - Intergenic
1003670770 6:8156328-8156350 TCTTTTCAACAAATAGTGCCAGG - Intergenic
1003686331 6:8306822-8306844 TCTCTTCAACAAACAGTGCTGGG - Intergenic
1005249958 6:23933881-23933903 TCTTTTCAATAAACAGAGTAGGG + Intergenic
1005437597 6:25831797-25831819 TATTTTTAGCAATCAGTGTGAGG - Intronic
1006071937 6:31504904-31504926 TCTTTTCAGCAAATAGTGCTGGG - Intronic
1006747512 6:36354485-36354507 TTTTTTCAACAAATAGTGTTGGG - Intergenic
1007274074 6:40660777-40660799 TCCATTCACCAAAAAGGGTGGGG - Intergenic
1007488018 6:42195688-42195710 TCTTTTCACTAGACCGTCTGAGG - Intergenic
1008095528 6:47335978-47336000 TCTGGTCACCAAAATGTGTGTGG - Intergenic
1008238537 6:49078843-49078865 TCTCTTCATTAAACAGTGTTGGG - Intergenic
1008280174 6:49587027-49587049 TCTGGTCACCAAGAAGTGTGTGG - Intergenic
1008424114 6:51336919-51336941 TCTTTTCAGCAAATAGTGCTAGG + Intergenic
1009395508 6:63194706-63194728 CCTTTTCAACAAATAGTGTTGGG - Intergenic
1009602490 6:65820358-65820380 TCTTTTCAATAAACAGTGCTGGG + Intergenic
1010038468 6:71354008-71354030 TCTGTTTACTATACAGTGTGGGG - Intergenic
1010328931 6:74598904-74598926 TCTTTTCTCCAGAGAGTTTGTGG + Intergenic
1010632280 6:78212418-78212440 TCTTTTCACCAAATGGTGTTAGG - Intergenic
1011332895 6:86229468-86229490 TCTTTTCAACAAACAGTGCTGGG - Intergenic
1011904878 6:92352218-92352240 TCTTTTGACCACCCAGTTTGTGG - Intergenic
1012077989 6:94718093-94718115 TCTTTTCAATAAACAGTGCTAGG + Intergenic
1012483900 6:99699014-99699036 TCTTTTCAACAAATAGTGCTGGG - Intergenic
1013430643 6:110052198-110052220 TGCTTTCACCAAACCCTGTGAGG - Intergenic
1013897547 6:115108105-115108127 TCTTTTCAACAAACGGTGGTGGG + Intergenic
1014242115 6:119028952-119028974 TCTGGTCACCAAAATGTGTGTGG - Intronic
1014562599 6:122909199-122909221 TCTTTTCAATAATTAGTGTGGGG + Intergenic
1015849254 6:137554727-137554749 TCTTTTCAACAAACGGTGCTGGG - Intergenic
1016398595 6:143653626-143653648 TCTTATCAGCAAACAGTGCTAGG + Intronic
1016859454 6:148702207-148702229 TCTTTTCCACAAACGGTGTGTGG - Intergenic
1017401148 6:154064721-154064743 TCTTTTCAACAAATGGTGTTGGG - Intronic
1018090472 6:160342608-160342630 TCTTTTCATCAAGCAGTTTTGGG - Intergenic
1018151200 6:160940991-160941013 TCTTTTCAACAAATAGTGGTGGG - Intergenic
1018603001 6:165565839-165565861 TCTTTTCAACAAATAGTGTCAGG + Intronic
1021381630 7:19974329-19974351 TCTTTTCCACAAACAGTGCTAGG - Intergenic
1021557670 7:21937854-21937876 TATTTTCAACAAACAGTGCTGGG + Intronic
1021756034 7:23853763-23853785 TCTTTTCAACAAATAGTGTTGGG + Intergenic
1023111652 7:36818768-36818790 TATTTTCAACAAATAGTGTGGGG + Intergenic
1024144194 7:46495015-46495037 TCTTTTCAGCAAATAGTGTTGGG + Intergenic
1024445316 7:49470843-49470865 TCTTGTCACCAAAATGTGCGAGG - Intergenic
1024858933 7:53815126-53815148 TCTTTTCATTAAACATTGTTGGG + Intergenic
1025986824 7:66460727-66460749 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1026028188 7:66764692-66764714 TCTTTTCACCAAATAGTGCCGGG - Intronic
1026485284 7:70813231-70813253 TATTTTCACCATTAAGTGTGAGG - Intergenic
1026883683 7:73923323-73923345 TCTTTTAACCACCCAGTCTGTGG - Intergenic
1027169160 7:75858304-75858326 TCTTTTCAACAGACGGTGTTGGG - Intronic
1027208966 7:76128435-76128457 TCTTTTGACCAAAGAGAGTATGG + Intergenic
1027210094 7:76139565-76139587 TCTTTTCAACAAACAGTGCTGGG + Intergenic
1029325627 7:99805946-99805968 TCTTTTCAACAAATAGTATTGGG + Intergenic
1030184533 7:106748256-106748278 TCTTTTCAACAAATGGTGCGGGG + Intergenic
1031654930 7:124343149-124343171 CCTCTTCACCACACACTGTGGGG + Intergenic
1031825973 7:126565944-126565966 TCTTTTCAACAAATAGTGTTGGG + Intronic
1032309990 7:130776651-130776673 TCTTTTCATCAAATAATGTGGGG - Intergenic
1032700471 7:134374378-134374400 TATTCTCCCCAAACAGTGGGTGG + Intergenic
1032996223 7:137449396-137449418 TCTTTTCAATAAATAGTGTTGGG + Intronic
1033603412 7:142907072-142907094 TCCTTTCACAACTCAGTGTGGGG + Intergenic
1034485869 7:151361851-151361873 TCTCTTCTGCAAACAGTGTAGGG + Intronic
1034545872 7:151788880-151788902 TCTTTTCAACAAATAGTGCTGGG - Intronic
1035625920 8:1070470-1070492 TGTTTTCACCACACATTTTGGGG - Intergenic
1036238123 8:7059737-7059759 TCTTTTCACTAAAAGGTGTAAGG - Intergenic
1036468560 8:9027710-9027732 CCTTTTCAACAAACGGTGTTGGG - Intronic
1037135214 8:15451870-15451892 TCTGGTCACCAAAATGTGTGGGG - Intronic
1037601675 8:20401426-20401448 TGTTTTCACCAATAAGTGGGAGG - Intergenic
1038301275 8:26351666-26351688 TCTTTTCACTAAATGGTGTTAGG - Intronic
1038550967 8:28468381-28468403 TCTTTTTGCCATTCAGTGTGAGG - Intronic
1038615172 8:29087161-29087183 TCTTTCTACCAAAGAGTTTGTGG - Intronic
1038896283 8:31786369-31786391 TCTAGTCACCAAGAAGTGTGTGG + Intronic
1039123980 8:34180108-34180130 TCTTTTCAACAAATAGTGCTAGG + Intergenic
1039448697 8:37653445-37653467 TCTTTTCAACCAACAGTGTTGGG + Intergenic
1039632081 8:39123084-39123106 TCTTTTCTACAAACAGTGCTGGG - Intronic
1039670932 8:39597509-39597531 TCTTTTCAACAAATGGTGTTGGG - Intronic
1039687373 8:39819285-39819307 TCTCTTCAACAAATGGTGTGAGG + Intronic
1039763170 8:40599931-40599953 TCCTTTCATCAAGCAGAGTGTGG + Intronic
1040732997 8:50472431-50472453 TCTTTTCAACAAATGGTGTTGGG + Intronic
1041041216 8:53848201-53848223 TTTTTTCAGCAAATGGTGTGGGG - Intergenic
1041266034 8:56065821-56065843 TCTCTTCAACAAATAGTGTTGGG + Intergenic
1041695974 8:60736396-60736418 TCTGTCCACCTACCAGTGTGTGG + Intronic
1042414823 8:68507491-68507513 TCTTTTTACCCAGGAGTGTGGGG + Intronic
1042469644 8:69170227-69170249 TCTCTTCAACAAATAGTGTTGGG - Intergenic
1042578830 8:70253661-70253683 TCTTTTCAACAAATAGTATTGGG + Intronic
1042670309 8:71255504-71255526 TCTTTTCAACAAACGGTGCTGGG + Intronic
1042783494 8:72519896-72519918 TCTTTTCAACAAACGGTGCTAGG + Intergenic
1042890628 8:73605966-73605988 TCTTTTCAGCCAATAGTGTTGGG + Intronic
1043179684 8:77071579-77071601 TCTTTTCAACAAATAGTGTAGGG - Intergenic
1043414936 8:80037974-80037996 TCCTTTGACCAAATAGTTTGTGG - Exonic
1043784604 8:84382626-84382648 TATATTCACCAAACACTGTAGGG - Intronic
1044014098 8:87029678-87029700 ACTTTTAACAAAATAGTGTGAGG - Intronic
1044583768 8:93849818-93849840 ACTTCTCACCAAACATGGTGAGG - Intergenic
1045723285 8:105139661-105139683 TTTTTTCTCCAAAATGTGTGTGG + Intronic
1045803543 8:106129236-106129258 TCTTTTCAACAGAGAGTGGGAGG + Intergenic
1047304925 8:123644951-123644973 TCATTTACCCACACAGTGTGTGG - Intergenic
1048389686 8:133950363-133950385 TCTTTTCAACAAATGGTGTTAGG + Intergenic
1048658060 8:136564757-136564779 GCTTTTCACTAAATAGTGTTGGG + Intergenic
1049984658 9:938077-938099 TCTTTTCAATAAACAATGTTGGG - Intronic
1050381876 9:5040211-5040233 TCTTTTAAACTAACAGTGCGGGG + Intronic
1050439541 9:5647040-5647062 TCTTTTCAACAAACAGTGCTGGG - Intronic
1051133434 9:13889954-13889976 TCTTTTCAACAAACAGTACTGGG + Intergenic
1051324649 9:15952112-15952134 TCTTTTCAACAAACAGTGCTAGG - Intronic
1051417745 9:16860444-16860466 TCTTTTCAACAAATAGTGCTGGG + Intronic
1051695056 9:19759494-19759516 TCAGTTCACAAAACAGTGTTTGG + Intronic
1052101844 9:24456529-24456551 TCTTTTCAAGAAACAATGTTTGG + Intergenic
1052133171 9:24876015-24876037 TCTTTTCAACAAATGGTGTTTGG - Intergenic
1052897254 9:33759361-33759383 TCTTTTTCCTAAACACTGTGAGG - Intronic
1053392950 9:37749092-37749114 GCTTTTCAACAAACAGTGAAGGG - Intronic
1053599672 9:39597860-39597882 TCTTTTCAACAAATGGTGTTGGG - Intergenic
1053640676 9:40074673-40074695 TATTTTCACAAATCAGTCTGAGG + Intergenic
1053765460 9:41390789-41390811 TATTTTCACAAATCAGTCTGAGG - Intergenic
1053857378 9:42352046-42352068 TCTTTTCAACAAATGGTGTTGGG - Intergenic
1054253855 9:62744526-62744548 TCTTTTCAACAAATGGTGTTGGG + Intergenic
1054321366 9:63670662-63670684 TATTTTCACAAATCAGTCTGAGG + Intergenic
1054567915 9:66778692-66778714 TCTTTTCAACAAATGGTGTTGGG + Intergenic
1054931118 9:70636384-70636406 TCTTTTTCCCAAACAGTCTGTGG - Intronic
1055151034 9:73000066-73000088 TCTTTTCAACAAACAGTGCTGGG - Intronic
1055742229 9:79402579-79402601 TATATTCACCACACAGTTTGAGG + Intergenic
1056995782 9:91456961-91456983 TTTTTTCAACAAACAGTGCTGGG - Intergenic
1057011882 9:91611505-91611527 TGCTTTCACCAAAAAATGTGGGG + Intronic
1057070652 9:92096595-92096617 TCTTTTCAACAAACGGTGCTAGG + Intronic
1057589214 9:96357291-96357313 TCTTTTCAACAAATAGTGCTGGG + Intronic
1059708829 9:116848727-116848749 TCTGGTCACCAAGAAGTGTGTGG + Intronic
1059866895 9:118524711-118524733 TCTCTTCAACAAACAGTGTTGGG + Intergenic
1059979141 9:119750439-119750461 TCTCTTCAACAAATAGTGTGGGG - Intergenic
1060092872 9:120760057-120760079 TCTTTTCATCAGACATTCTGAGG + Exonic
1061254874 9:129449203-129449225 TCGTGTCCACAAACAGTGTGTGG + Intergenic
1061526473 9:131168808-131168830 TCTTTTCAATAAATAGTGTTAGG - Intronic
1061852960 9:133426502-133426524 TCTTTTAATCAAACAGTATCAGG - Intronic
1062096132 9:134704800-134704822 TTTTTTCCCTTAACAGTGTGAGG + Intronic
1062442977 9:136579302-136579324 TCATTTCAGCACCCAGTGTGTGG - Intergenic
1062663573 9:137654023-137654045 TCTTTTCAGCAAACAGTGCTAGG - Intronic
1202788447 9_KI270719v1_random:57769-57791 TATTTTCACAAATCAGTCTGAGG + Intergenic
1203437404 Un_GL000195v1:152825-152847 TCTCTTCAACAAACAGTATTGGG - Intergenic
1185483512 X:465558-465580 CCCTTTCCCCAAACACTGTGGGG - Intergenic
1186195138 X:7103316-7103338 TCTCTTCAACAAACAGTGTTGGG + Intronic
1186380920 X:9058096-9058118 TCTCTTCAACAAACGGTGTTGGG + Intronic
1187118671 X:16381436-16381458 TCTCTTCAACAAATAGTGTTGGG + Intergenic
1187362182 X:18638948-18638970 TCTTTTCAGCAAATAGTGGTGGG + Intronic
1187483349 X:19678582-19678604 TCTTTTCAATAAACAGTGCTGGG + Intronic
1187794170 X:22983359-22983381 TCTCTTCAACAAACAGTGTTGGG + Intergenic
1187902315 X:24036333-24036355 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1188327817 X:28828473-28828495 TCTTTTCAACAAATAGTCTAGGG - Intronic
1188555190 X:31403878-31403900 TATTTACACCAAACAGTTTAGGG + Intronic
1189957445 X:46289759-46289781 TCTCTTCAACAAATAGTGTTGGG - Intergenic
1190004550 X:46722971-46722993 TCTGTTCAGCCATCAGTGTGAGG + Intronic
1190849636 X:54226051-54226073 TCTTTTCAACAAAAAGTGCTAGG + Intronic
1191046527 X:56144087-56144109 TTTCTTCACCAAATAGTCTGGGG + Intergenic
1191218720 X:57962428-57962450 TCATTTCAACAAATAGTGTTGGG - Intergenic
1192038161 X:67588289-67588311 CCTTTTAATCAAACAGTGTGGGG - Intronic
1192317545 X:70064453-70064475 TCTTTTCATCAAAACTTGTGTGG + Intergenic
1193099131 X:77588186-77588208 TCTTTTCAACAAACAGTCCTGGG + Intronic
1193325443 X:80174614-80174636 CCTTTTCAACAAATGGTGTGGGG - Intergenic
1193424002 X:81318670-81318692 TCTTTTCAATAAACAGTGCTGGG - Intergenic
1193442122 X:81555531-81555553 TCTTTTCAATAAACGGTGTTGGG - Intergenic
1193730845 X:85100958-85100980 TCTTTTCAACAAACAGTACTAGG + Intronic
1194126262 X:90020881-90020903 TCTTTTCATCAAAGGATGTGAGG - Intergenic
1194157334 X:90407154-90407176 TCTTTTTAGCAAACAGTGCTAGG - Intergenic
1194281638 X:91960821-91960843 TCTCTTCAACAAACTGTGTTGGG - Intronic
1194314497 X:92358341-92358363 TCTTTTCACCATTATGTGTGTGG - Intronic
1194791155 X:98151703-98151725 TCTCTTCAACAAATAGTGTTGGG - Intergenic
1195215485 X:102696992-102697014 TCTTTTCAACAAATGGTGTTGGG + Intergenic
1196521938 X:116684332-116684354 TCTTTTCAACAAATGGTGTCTGG - Intergenic
1196727235 X:118907112-118907134 TCTCTTCAACAAACGGTGTTGGG - Intergenic
1197545696 X:127821137-127821159 TCTATTCAACAAACAGTGCTGGG + Intergenic
1198974622 X:142322225-142322247 ACTTTGCACTAGACAGTGTGGGG - Intergenic
1199663831 X:150081096-150081118 TCTCTTCACCAAACAGCATGGGG - Intergenic
1200503666 Y:3984146-3984168 TCTTTTTAGCAAACAGTGCTAGG - Intergenic
1200599232 Y:5185476-5185498 TCTCTTCAACAAACTGTGTCAGG - Intronic
1200622554 Y:5469863-5469885 TCTTTTCACCATTATGTGTGTGG - Intronic
1201567241 Y:15379051-15379073 TCTCTTCAACAAACAGTGCTTGG + Intergenic