ID: 939908269

View in Genome Browser
Species Human (GRCh38)
Location 2:147946156-147946178
Sequence CTATAAATAAAGAGGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939908269_939908272 13 Left 939908269 2:147946156-147946178 CCCAGCATCCTCTTTATTTATAG No data
Right 939908272 2:147946192-147946214 TGCTCAGAATGCAACACAGTTGG No data
939908269_939908273 14 Left 939908269 2:147946156-147946178 CCCAGCATCCTCTTTATTTATAG No data
Right 939908273 2:147946193-147946215 GCTCAGAATGCAACACAGTTGGG No data
939908269_939908274 18 Left 939908269 2:147946156-147946178 CCCAGCATCCTCTTTATTTATAG No data
Right 939908274 2:147946197-147946219 AGAATGCAACACAGTTGGGAAGG No data
939908269_939908275 25 Left 939908269 2:147946156-147946178 CCCAGCATCCTCTTTATTTATAG No data
Right 939908275 2:147946204-147946226 AACACAGTTGGGAAGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939908269 Original CRISPR CTATAAATAAAGAGGATGCT GGG (reversed) Intronic
No off target data available for this crispr