ID: 939908996

View in Genome Browser
Species Human (GRCh38)
Location 2:147956525-147956547
Sequence CTTAGGTTCTTATAATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939908994_939908996 6 Left 939908994 2:147956496-147956518 CCAGAAAAGCTGTGGGTTGAATT No data
Right 939908996 2:147956525-147956547 CTTAGGTTCTTATAATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939908996 Original CRISPR CTTAGGTTCTTATAATGTCC AGG Intronic
No off target data available for this crispr