ID: 939909442

View in Genome Browser
Species Human (GRCh38)
Location 2:147962620-147962642
Sequence CCAATCTGGCAGTCCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939909434_939909442 7 Left 939909434 2:147962590-147962612 CCCCTTGCTGCCACACTTCCAGC No data
Right 939909442 2:147962620-147962642 CCAATCTGGCAGTCCCACCCAGG No data
939909435_939909442 6 Left 939909435 2:147962591-147962613 CCCTTGCTGCCACACTTCCAGCC No data
Right 939909442 2:147962620-147962642 CCAATCTGGCAGTCCCACCCAGG No data
939909432_939909442 28 Left 939909432 2:147962569-147962591 CCTACACAGCAAGGAAACCAACC No data
Right 939909442 2:147962620-147962642 CCAATCTGGCAGTCCCACCCAGG No data
939909433_939909442 11 Left 939909433 2:147962586-147962608 CCAACCCCTTGCTGCCACACTTC No data
Right 939909442 2:147962620-147962642 CCAATCTGGCAGTCCCACCCAGG No data
939909437_939909442 -3 Left 939909437 2:147962600-147962622 CCACACTTCCAGCCAGAGAACCA No data
Right 939909442 2:147962620-147962642 CCAATCTGGCAGTCCCACCCAGG No data
939909436_939909442 5 Left 939909436 2:147962592-147962614 CCTTGCTGCCACACTTCCAGCCA No data
Right 939909442 2:147962620-147962642 CCAATCTGGCAGTCCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939909442 Original CRISPR CCAATCTGGCAGTCCCACCC AGG Intronic
No off target data available for this crispr