ID: 939916013 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:148044340-148044362 |
| Sequence | TACTAAATAGTTCAGCCCCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939916013_939916014 | 18 | Left | 939916013 | 2:148044340-148044362 | CCATGGGGCTGAACTATTTAGTA | No data | ||
| Right | 939916014 | 2:148044381-148044403 | ATACCATGACACTGAGAACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939916013 | Original CRISPR | TACTAAATAGTTCAGCCCCA TGG (reversed) | Intronic | ||