ID: 939916013

View in Genome Browser
Species Human (GRCh38)
Location 2:148044340-148044362
Sequence TACTAAATAGTTCAGCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939916013_939916014 18 Left 939916013 2:148044340-148044362 CCATGGGGCTGAACTATTTAGTA No data
Right 939916014 2:148044381-148044403 ATACCATGACACTGAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939916013 Original CRISPR TACTAAATAGTTCAGCCCCA TGG (reversed) Intronic