ID: 939918717

View in Genome Browser
Species Human (GRCh38)
Location 2:148081782-148081804
Sequence ATGTAGAATAAGAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939918717_939918724 12 Left 939918717 2:148081782-148081804 CCTTCCCCATTCTTATTCTACAT No data
Right 939918724 2:148081817-148081839 ACTGTAACTTATGGTTTTGTGGG No data
939918717_939918725 24 Left 939918717 2:148081782-148081804 CCTTCCCCATTCTTATTCTACAT No data
Right 939918725 2:148081829-148081851 GGTTTTGTGGGAGAAATTCCAGG No data
939918717_939918721 3 Left 939918717 2:148081782-148081804 CCTTCCCCATTCTTATTCTACAT No data
Right 939918721 2:148081808-148081830 ACCTACTGCACTGTAACTTATGG No data
939918717_939918723 11 Left 939918717 2:148081782-148081804 CCTTCCCCATTCTTATTCTACAT No data
Right 939918723 2:148081816-148081838 CACTGTAACTTATGGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939918717 Original CRISPR ATGTAGAATAAGAATGGGGA AGG (reversed) Intronic
No off target data available for this crispr