ID: 939928903

View in Genome Browser
Species Human (GRCh38)
Location 2:148207564-148207586
Sequence GTGGAAGAATGAGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939928897_939928903 7 Left 939928897 2:148207534-148207556 CCATAACAGATCATTCGAGGGTG No data
Right 939928903 2:148207564-148207586 GTGGAAGAATGAGGAAACACTGG No data
939928893_939928903 15 Left 939928893 2:148207526-148207548 CCCTCAGTCCATAACAGATCATT No data
Right 939928903 2:148207564-148207586 GTGGAAGAATGAGGAAACACTGG No data
939928894_939928903 14 Left 939928894 2:148207527-148207549 CCTCAGTCCATAACAGATCATTC No data
Right 939928903 2:148207564-148207586 GTGGAAGAATGAGGAAACACTGG No data
939928892_939928903 16 Left 939928892 2:148207525-148207547 CCCCTCAGTCCATAACAGATCAT No data
Right 939928903 2:148207564-148207586 GTGGAAGAATGAGGAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939928903 Original CRISPR GTGGAAGAATGAGGAAACAC TGG Intronic
No off target data available for this crispr