ID: 939932521

View in Genome Browser
Species Human (GRCh38)
Location 2:148253321-148253343
Sequence ATGTACAATAGGAAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939932519_939932521 25 Left 939932519 2:148253273-148253295 CCTTTATATGTAGTTATTCATTT No data
Right 939932521 2:148253321-148253343 ATGTACAATAGGAAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939932521 Original CRISPR ATGTACAATAGGAAAACTGC TGG Intronic
No off target data available for this crispr