ID: 939932521 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:148253321-148253343 |
Sequence | ATGTACAATAGGAAAACTGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
939932519_939932521 | 25 | Left | 939932519 | 2:148253273-148253295 | CCTTTATATGTAGTTATTCATTT | No data | ||
Right | 939932521 | 2:148253321-148253343 | ATGTACAATAGGAAAACTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
939932521 | Original CRISPR | ATGTACAATAGGAAAACTGC TGG | Intronic | ||
No off target data available for this crispr |