ID: 939933014

View in Genome Browser
Species Human (GRCh38)
Location 2:148256541-148256563
Sequence TGGTAATCTGTATCAATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939933014_939933015 -5 Left 939933014 2:148256541-148256563 CCAGCTATTGATACAGATTACCA No data
Right 939933015 2:148256559-148256581 TACCATCAGTGTCACCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939933014 Original CRISPR TGGTAATCTGTATCAATAGC TGG (reversed) Intronic
No off target data available for this crispr