ID: 939933362

View in Genome Browser
Species Human (GRCh38)
Location 2:148258816-148258838
Sequence CATGGGGGCCCCCCTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939933354_939933362 -10 Left 939933354 2:148258803-148258825 CCCCCTTTTCTCCCATGGGGGCC No data
Right 939933362 2:148258816-148258838 CATGGGGGCCCCCCTGTGGGTGG No data
939933348_939933362 14 Left 939933348 2:148258779-148258801 CCATGAGCGTGTCACTTGTTGAG No data
Right 939933362 2:148258816-148258838 CATGGGGGCCCCCCTGTGGGTGG No data
939933347_939933362 20 Left 939933347 2:148258773-148258795 CCATATCCATGAGCGTGTCACTT No data
Right 939933362 2:148258816-148258838 CATGGGGGCCCCCCTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939933362 Original CRISPR CATGGGGGCCCCCCTGTGGG TGG Intronic
No off target data available for this crispr