ID: 939945897

View in Genome Browser
Species Human (GRCh38)
Location 2:148410539-148410561
Sequence CCACTCAGTGGGACTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939945897_939945903 -10 Left 939945897 2:148410539-148410561 CCTGCCTCAGTCCCACTGAGTGG No data
Right 939945903 2:148410552-148410574 CACTGAGTGGCTAGGACTACAGG No data
939945897_939945905 19 Left 939945897 2:148410539-148410561 CCTGCCTCAGTCCCACTGAGTGG No data
Right 939945905 2:148410581-148410603 CCACCACACCTAGCTAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939945897 Original CRISPR CCACTCAGTGGGACTGAGGC AGG (reversed) Intronic
No off target data available for this crispr