ID: 939949215

View in Genome Browser
Species Human (GRCh38)
Location 2:148448380-148448402
Sequence CTGTGTCTGAATATGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939949215_939949220 3 Left 939949215 2:148448380-148448402 CCTAGATACATATTCAGACACAG No data
Right 939949220 2:148448406-148448428 ATTTGGGTGGGTTTCTTCAGTGG No data
939949215_939949221 4 Left 939949215 2:148448380-148448402 CCTAGATACATATTCAGACACAG No data
Right 939949221 2:148448407-148448429 TTTGGGTGGGTTTCTTCAGTGGG No data
939949215_939949222 9 Left 939949215 2:148448380-148448402 CCTAGATACATATTCAGACACAG No data
Right 939949222 2:148448412-148448434 GTGGGTTTCTTCAGTGGGTAAGG No data
939949215_939949218 -10 Left 939949215 2:148448380-148448402 CCTAGATACATATTCAGACACAG No data
Right 939949218 2:148448393-148448415 TCAGACACAGTGTATTTGGGTGG No data
939949215_939949219 -9 Left 939949215 2:148448380-148448402 CCTAGATACATATTCAGACACAG No data
Right 939949219 2:148448394-148448416 CAGACACAGTGTATTTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939949215 Original CRISPR CTGTGTCTGAATATGTATCT AGG (reversed) Intronic
No off target data available for this crispr