ID: 939949958

View in Genome Browser
Species Human (GRCh38)
Location 2:148458296-148458318
Sequence AGAATGTGGCCTATAAAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939949952_939949958 23 Left 939949952 2:148458250-148458272 CCTGCAACACCTTGGATTCAGAT 0: 1
1: 0
2: 1
3: 14
4: 166
Right 939949958 2:148458296-148458318 AGAATGTGGCCTATAAAGGCGGG 0: 1
1: 0
2: 2
3: 7
4: 153
939949951_939949958 27 Left 939949951 2:148458246-148458268 CCAACCTGCAACACCTTGGATTC 0: 1
1: 0
2: 0
3: 10
4: 210
Right 939949958 2:148458296-148458318 AGAATGTGGCCTATAAAGGCGGG 0: 1
1: 0
2: 2
3: 7
4: 153
939949954_939949958 14 Left 939949954 2:148458259-148458281 CCTTGGATTCAGATTGGAAGATA 0: 1
1: 0
2: 1
3: 11
4: 143
Right 939949958 2:148458296-148458318 AGAATGTGGCCTATAAAGGCGGG 0: 1
1: 0
2: 2
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939949958 Original CRISPR AGAATGTGGCCTATAAAGGC GGG Exonic
905814479 1:40938569-40938591 GGAAGATGGCCTGTAAAGGCCGG + Intergenic
906217002 1:44047906-44047928 TGGATGTGGCCAATAAAGGTGGG + Intergenic
909540872 1:76790110-76790132 AGAATGTGCTCTTCAAAGGCAGG + Intergenic
909656577 1:78039912-78039934 AGAATGTGGTCTAGAAAGGAGGG + Intronic
912531489 1:110327017-110327039 AGTATGTGCTCAATAAAGGCTGG + Intergenic
913179353 1:116306051-116306073 AGAATGTGCTATAAAAAGGCAGG - Intergenic
915466178 1:156099367-156099389 AGAATGTGGCCTTTGAAGCTAGG + Intronic
915775851 1:158485430-158485452 AGAATTTGGTATCTAAAGGCAGG - Intergenic
916456925 1:164980531-164980553 AGAATGTGGCATATAACTTCAGG - Intergenic
922148430 1:222973823-222973845 AGTATGTGGCCAATAAAGCACGG + Intronic
922455943 1:225773611-225773633 AGAATGGGGCCAAAAAAGCCAGG + Intergenic
924075451 1:240329678-240329700 AGAATGTGGCCAATACATGTTGG + Intronic
1062841200 10:673213-673235 ACCACGTGGCCTCTAAAGGCTGG - Intronic
1063196655 10:3749672-3749694 GGAATCTGGGCTGTAAAGGCAGG + Intergenic
1065554566 10:26902349-26902371 AAAATGTGGCACATATAGGCCGG + Intergenic
1067737865 10:48872688-48872710 TTAATGTGGTCTATAAATGCAGG + Intronic
1068711188 10:60135815-60135837 AGAATGAGGCCTCTAATGTCAGG - Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070883920 10:79873686-79873708 AGAAAGTGGCTTCTAGAGGCTGG - Intergenic
1074374289 10:112926593-112926615 AGAATGGGGCCAAAAAAGTCAGG - Intergenic
1082641702 11:55669069-55669091 AGAATGTGGGCTATAAAGACAGG + Intergenic
1083198303 11:61104211-61104233 ACAATGCGGCCTCCAAAGGCAGG + Intronic
1083974837 11:66109627-66109649 AAAATGTGGAAGATAAAGGCTGG - Intronic
1084280891 11:68092364-68092386 TGAATCTGGCCTATAATGGAAGG - Intronic
1084671573 11:70609945-70609967 AGAATGTGGCCTTTTACGCCTGG - Intronic
1085126762 11:74007261-74007283 TGAATTTGGCCTATAAAAACAGG + Intronic
1085655932 11:78314921-78314943 TGAACGTGGTCTGTAAAGGCAGG + Intronic
1087358544 11:97126441-97126463 AGAATGTAGCCTTTTAAGACTGG + Intergenic
1088994938 11:114987910-114987932 GGAATGTTGCCTCTAAAGTCAGG + Intergenic
1089644400 11:119869159-119869181 AGAATGGGAACTATGAAGGCAGG - Intergenic
1089863393 11:121610619-121610641 AGAATGTGGCCTCTGGAAGCTGG - Intronic
1091055571 11:132415524-132415546 AGAATGTAGCCTCAAAAGGATGG + Exonic
1093652030 12:21657360-21657382 ACCAGGTGGCCTATGAAGGCTGG - Intronic
1094523623 12:31218016-31218038 AGAATGTTTCCTATGAAGCCAGG + Intergenic
1095950376 12:47778458-47778480 AGACTGTGGCCTCTGAGGGCTGG + Intronic
1098103183 12:67040759-67040781 AGAATGTGCTCAATAAAGGTTGG + Intergenic
1100627659 12:96352471-96352493 ACAAACTGGGCTATAAAGGCTGG + Intronic
1100665028 12:96741845-96741867 AGACTGTGGACTCTGAAGGCAGG + Intronic
1100798872 12:98210864-98210886 AGAATTTGGCCCATAAAAGCAGG + Intergenic
1102407734 12:112688281-112688303 AAAATGTTGTGTATAAAGGCAGG + Intronic
1102913022 12:116732808-116732830 AGAATGTGGGCTTTAAAATCAGG + Intronic
1106455008 13:29919367-29919389 TGACTGTGCCCTATAGAGGCGGG + Intergenic
1106975505 13:35207922-35207944 AGAATTTGGCATTTAAAGTCTGG + Intronic
1107418348 13:40222212-40222234 TGTCTGTGGCCTCTAAAGGCTGG - Intergenic
1109773697 13:67011275-67011297 AGAATTTAGACTATAAATGCAGG - Intronic
1112200436 13:97269035-97269057 AGGAGGTGGCTTAGAAAGGCAGG + Intronic
1115225278 14:31095713-31095735 AAAATGTGGCATAAAAAGACTGG - Intronic
1119446279 14:74666553-74666575 AGAATGTAGCCCATGAGGGCTGG + Intronic
1120421277 14:84289311-84289333 AAAACGTGGCCTCTAAAGTCTGG - Intergenic
1121851020 14:97221121-97221143 AGAATATGCCCGATAAAGGAAGG + Intergenic
1126259890 15:46676981-46677003 AACATGTGCTCTATAAAGGCAGG - Intergenic
1126969056 15:54089118-54089140 AGAATTTGGACTATCAAAGCAGG - Intronic
1129017626 15:72482538-72482560 AGAATGGAGCTTATAAATGCTGG + Intronic
1129103465 15:73287909-73287931 AGTCTGTGGCTTATAAAGGAGGG - Intronic
1130174670 15:81555702-81555724 AGAATGTGACCTTTAGAGTCTGG - Intergenic
1131389574 15:92035825-92035847 AGCCTGTGGCTTATAAAGCCTGG + Intronic
1139667485 16:68467845-68467867 GAACTGTGGCCTGTAAAGGCTGG + Intergenic
1139737844 16:69007559-69007581 AAAATGTGGCATATCCAGGCCGG - Intronic
1141040366 16:80667865-80667887 AGAATCTGGCCCACAGAGGCTGG + Intronic
1141246576 16:82313359-82313381 AGAAAGAGGCCTAACAAGGCAGG + Intergenic
1141747535 16:85935819-85935841 TGCAGGTGGCCTCTAAAGGCTGG + Intergenic
1144056889 17:11551314-11551336 AGACTGTGTCATTTAAAGGCAGG + Intronic
1147047951 17:37768675-37768697 AGAATGTTGTCTGTGAAGGCAGG - Intergenic
1149231882 17:54544472-54544494 AGGATCTGGCCTAAACAGGCAGG - Intergenic
1150207174 17:63417845-63417867 AGAAGGTGTCCTGTAAAGTCCGG - Intronic
1153586944 18:6631798-6631820 AGAATGTGGCCCATAGAGTGGGG - Intergenic
1155362218 18:25014918-25014940 AGAATGTGGCTTATATCTGCAGG - Intergenic
1157927927 18:51786680-51786702 ACAATGTGGCCTTTAATGGAAGG + Intergenic
1168191393 19:54740947-54740969 TGCAGGTGGCCTATAGAGGCTGG + Intronic
1168195723 19:54772314-54772336 TGCAGGTGGCCTATAGAGGCTGG + Intronic
1168197614 19:54787165-54787187 TGCAGGTGGCCTATAGAGGCTGG + Intronic
1168204095 19:54836544-54836566 TGCAGGTGGCCTATAGAGGCTGG + Intronic
1168235261 19:55059013-55059035 AGAATGTGGCTTCTATAGACAGG - Intronic
1168276480 19:55281404-55281426 AGAGTGTGGCCTCTAGAAGCTGG - Intergenic
925967273 2:9077646-9077668 AGCATGTGGCCTAAACAGCCAGG - Intergenic
926984907 2:18612059-18612081 AGAATGAGGTTTATAAAGGGTGG + Intergenic
933663897 2:84949115-84949137 AGACTGTGGCCTACAATGCCCGG + Intergenic
934164258 2:89280096-89280118 AGAATGTGCCCTAGAAATTCAGG + Intergenic
934203016 2:89902428-89902450 AGAATGTGCCCTAGAAATTCAGG - Intergenic
935511771 2:103984552-103984574 AGAAAGTGGCCAGTAGAGGCCGG - Intergenic
939949958 2:148458296-148458318 AGAATGTGGCCTATAAAGGCGGG + Exonic
940723010 2:157302179-157302201 AAAATTTGGCCTAAAAGGGCGGG - Intronic
941189824 2:162367448-162367470 AGAATGTATTCTATAAAGGCTGG - Intronic
947764143 2:232625072-232625094 AGAATGTGGGCCATAAAGGCAGG + Intronic
948114151 2:235481334-235481356 AGAATGTTTCCTTTAAAGCCAGG - Intergenic
948561170 2:238854216-238854238 AGAATGTGAACTAAAAAGACAGG - Intronic
1169785155 20:9351887-9351909 AGAATGTGACCGATAAATACAGG + Intronic
1172501743 20:35432696-35432718 ATAATGTGTAATATAAAGGCAGG + Intergenic
1173379824 20:42530237-42530259 AGAAGGTGATCTTTAAAGGCTGG - Intronic
1174813256 20:53665505-53665527 AGAATATGGCCTATAAAAAATGG - Intergenic
1181920988 22:26320350-26320372 AGAATGGGGCCAATAAGGGGGGG + Intronic
1183032392 22:35115975-35115997 AGAATGAGGCCTAGAGAGGTGGG - Intergenic
949596057 3:5548248-5548270 AGGATGTGGCCAATGAAGACAGG - Intergenic
950070881 3:10151538-10151560 AAAATCTGCCCTAAAAAGGCTGG - Exonic
950324858 3:12097308-12097330 AAAATGTGGCACATAATGGCCGG + Intronic
950449951 3:13059889-13059911 AGACTGTGGCCTCTGAGGGCAGG - Intronic
952561164 3:34595200-34595222 AGAATATGGGCTTTAAAGTCAGG + Intergenic
953954895 3:47224239-47224261 AGAATGTGACATTTAAAGCCGGG + Intergenic
954278471 3:49558235-49558257 AGAATGTGGTCTACACAGGCAGG + Intronic
958470881 3:94517569-94517591 AGAATTTGACCTAAAAAGGGAGG + Intergenic
966358313 3:179106174-179106196 TGAAACTGGCCAATAAAGGCTGG + Intergenic
969933605 4:10658678-10658700 GGAAGGTGGCTTCTAAAGGCAGG + Intronic
972509986 4:39759877-39759899 AGAATGTGGCTTAACCAGGCAGG + Intronic
974223735 4:59011284-59011306 AGAATGTGGCCTAGAAAAAAAGG + Intergenic
974748615 4:66107477-66107499 AGAATTTGGACTATAAAAACAGG - Intergenic
977211759 4:94226421-94226443 AAGATGTGGCCAAGAAAGGCAGG - Intronic
980386395 4:132091581-132091603 AGAATGATGGCTATAATGGCGGG - Intergenic
980685618 4:136223994-136224016 AGTATGTGCCCAATGAAGGCAGG + Intergenic
981389683 4:144173921-144173943 AGAATGTGGTGTATAAAGAGTGG + Intergenic
982677910 4:158397331-158397353 AGAAGGTGGCATCTACAGGCAGG + Intronic
984405587 4:179325439-179325461 AGGATGTGGCCTGTAAGGTCTGG - Intergenic
986301282 5:6480183-6480205 AGAGTGTGGCCTCCAAAGCCAGG + Intronic
992570761 5:78054669-78054691 GGACTGTGGCCTCTAAAAGCTGG + Intronic
992620879 5:78591646-78591668 AGAAAGTGTTCCATAAAGGCAGG - Intronic
992881333 5:81113437-81113459 AGATTGTGACCTATAAATGAAGG + Intronic
993304280 5:86255541-86255563 AGAATGTAGAATATACAGGCAGG - Intergenic
996437730 5:123453953-123453975 AGAATGTGGCATCAAGAGGCAGG - Intergenic
1002648773 5:180675964-180675986 AGTATGTGGCCTTTACAGACTGG + Intergenic
1010953648 6:82066498-82066520 GGAATGGGACCTCTAAAGGCTGG - Intergenic
1011601257 6:89062317-89062339 AAAATGTGGCATAAAAAGACTGG - Intergenic
1012609789 6:101202660-101202682 AGAATGTGGCATATAATTGATGG + Intergenic
1015028850 6:128569869-128569891 AGGGTGTGGCCTGGAAAGGCTGG + Intergenic
1016154654 6:140789962-140789984 AGAATGTTTCCTCTAAAGGGAGG - Intergenic
1017023076 6:150157258-150157280 AGAGTGTGGTCTATACAGGAGGG + Intronic
1017673957 6:156794953-156794975 AGAATTTGGGCTACAAGGGCTGG + Intronic
1018351491 6:162964510-162964532 AGGATATGGCCTATGAAGGCTGG + Intronic
1020365672 7:7378366-7378388 GGAATGTAGCCACTAAAGGCAGG - Intronic
1021492053 7:21230028-21230050 AAAATGTGGTATATATAGGCCGG + Intergenic
1021990474 7:26136688-26136710 AGAAACTGGCTTATATAGGCCGG - Intergenic
1022157362 7:27673938-27673960 AAAATGTGGCACATATAGGCTGG + Intergenic
1023105893 7:36762999-36763021 ACAATTTGGCCTATCCAGGCAGG + Intergenic
1024549963 7:50554487-50554509 ATAATGTGTCCTAGAAAGGGAGG - Intronic
1025760893 7:64390312-64390334 AGAAAATGGCCTAAAAAGGTAGG - Intergenic
1026933036 7:74235476-74235498 AGAATGTGGCCCATAGTGGCCGG - Intronic
1027546204 7:79530094-79530116 AAAATCTGCCCCATAAAGGCAGG - Intergenic
1032866899 7:135934932-135934954 AGAATGAGGACAATAAAGGTTGG - Intronic
1034199951 7:149278118-149278140 AGAATCTGGCATTTTAAGGCAGG - Intronic
1034504710 7:151479005-151479027 AGAAAGTAGACTTTAAAGGCCGG - Intronic
1037211530 8:16393999-16394021 AGAATGAGGCATAGAAAGTCTGG - Intronic
1039298687 8:36185794-36185816 AGGATCTGGCCTATAAAAACAGG - Intergenic
1039386346 8:37139166-37139188 AGAAAGGGGTCTATGAAGGCTGG - Intergenic
1040849910 8:51889054-51889076 AGAATGTGTCCTATATAGTCAGG - Intronic
1041407451 8:57515749-57515771 AGCAAATGGCCTAAAAAGGCGGG + Intergenic
1041823116 8:62062400-62062422 TGAAGGCAGCCTATAAAGGCTGG + Intergenic
1042905317 8:73766431-73766453 AGAAAGTGGATAATAAAGGCTGG + Intronic
1043416107 8:80051858-80051880 AGACAGAGTCCTATAAAGGCAGG + Intronic
1044723107 8:95169414-95169436 GCAATGTGGACTGTAAAGGCTGG + Intergenic
1046141093 8:110093276-110093298 AGAATGTGGCCTTTATAGTAAGG - Intergenic
1046296904 8:112231545-112231567 ACAATTTGGCCTACAAAGACTGG - Exonic
1047722049 8:127650059-127650081 AGAGTGTGGCCTTTAGAGACAGG + Intergenic
1048460342 8:134616083-134616105 AGACTCTGGCCTACAAAAGCAGG + Intronic
1050206845 9:3205356-3205378 AGATTGTGTCCAATAAAAGCTGG + Intergenic
1055196677 9:73602408-73602430 ATTATATAGCCTATAAAGGCAGG - Intergenic
1055741687 9:79396702-79396724 GGTATGTGGCCTATAAACGTAGG - Intergenic
1056309236 9:85322510-85322532 AGAAAATGGCCCAGAAAGGCTGG + Intergenic
1057121159 9:92575515-92575537 AGAATGTCTCCTATCCAGGCTGG + Intronic
1057558916 9:96112079-96112101 AGAAGGTGGGCAAAAAAGGCAGG - Intronic
1059854483 9:118381405-118381427 AGAATGTGGCTTATATATGTAGG + Intergenic
1060623478 9:125089341-125089363 AGAATATGGCCCAAAAAAGCAGG + Intronic
1189010065 X:37038077-37038099 AGAATGTGGCCTTCAAAAGTTGG + Intergenic
1189038520 X:37517653-37517675 AGAATGTGGCCTTCAAAAGTTGG - Intronic
1189848344 X:45156565-45156587 AGAGTGTGGCCTTTGAGGGCAGG + Intronic
1192419230 X:71014178-71014200 AGAATTTGCCCTAAAAGGGCAGG - Intergenic