ID: 939951908

View in Genome Browser
Species Human (GRCh38)
Location 2:148485430-148485452
Sequence TAAAATCTAAAAATAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 961
Summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 894}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939951907_939951908 7 Left 939951907 2:148485400-148485422 CCTTTAATTTTAGGTGCTCTAAA 0: 1
1: 0
2: 3
3: 21
4: 255
Right 939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG 0: 1
1: 0
2: 6
3: 60
4: 894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939951908 Original CRISPR TAAAATCTAAAAATAGATGA AGG Intronic
900074467 1:801902-801924 GAAAACATAAAAATAAATGATGG + Intergenic
901253657 1:7801832-7801854 TAAAATGTTAAAATAAATGTGGG - Intronic
901360080 1:8690590-8690612 TAAAATTTAAGAACAGATGAGGG + Intronic
901894684 1:12300786-12300808 TCAAATGCAAAAATGGATGAAGG - Intronic
902433386 1:16380906-16380928 TAAAAAAAAAAAAAAGATGAGGG - Intronic
902826474 1:18977968-18977990 CAAATTCTATCAATAGATGAAGG - Intergenic
902857379 1:19218412-19218434 TAAAAACTAAAAATAAATAATGG + Exonic
904018400 1:27442247-27442269 TAAAAACTAAAAATAAAGGCTGG + Intronic
906490945 1:46268042-46268064 AAAAATCTGAAGATGGATGATGG - Intronic
906742355 1:48195209-48195231 ACAAATTTAAAAATAAATGATGG - Intergenic
907203063 1:52744235-52744257 AAAAATCTAAACATAGAAAAAGG - Intronic
907713473 1:56906189-56906211 TCAGATCTAAAAATAGTTCATGG + Intronic
907762781 1:57377887-57377909 TAGAATCTAAAAATAGAGGCTGG + Intronic
907854362 1:58287323-58287345 TAAAATTTAAAAAAAGATACAGG + Intronic
908366502 1:63429300-63429322 AATAATGTAAAATTAGATGATGG - Intronic
908477083 1:64500056-64500078 TAACATCTCAAGATAGAAGAAGG - Intronic
908882942 1:68753408-68753430 GAAAAACTAAGAATAGATGTGGG - Intergenic
908945724 1:69494130-69494152 ATAAATCTAAAAATTAATGATGG + Intergenic
908955808 1:69625501-69625523 AAACATCTAAAAATATAGGAAGG - Intronic
908986820 1:70034072-70034094 TAAAATATAAAAATAGAAATAGG + Intronic
909008925 1:70310340-70310362 TAAAATCTAATAAAAGATCTAGG + Intronic
909310675 1:74144023-74144045 TAAAATGCATAAATAGATGTTGG + Intronic
909349419 1:74632837-74632859 TAAACTCTAAAACAATATGAAGG - Intronic
909669694 1:78174129-78174151 TAAAATAAAAAAGTAGAGGAAGG - Intergenic
909856264 1:80536233-80536255 TAAAACATAAAAATAATTGAGGG - Intergenic
909871180 1:80741122-80741144 GTACATCTAAAAATAGCTGAAGG + Intergenic
909981440 1:82106405-82106427 TATATTCTCAAAATTGATGAAGG - Intergenic
910231045 1:84986866-84986888 AAAAATCAAAAAATAGATGTTGG + Intronic
910335289 1:86121612-86121634 TATAATTTAAAAATCAATGAAGG + Intronic
910566142 1:88645164-88645186 TAAAAAATAAAAATAGAACATGG - Intergenic
910592465 1:88941032-88941054 TAATTTCTAAAAAGAGATTAGGG + Intronic
910648157 1:89535609-89535631 TACATTCTTAAAATGGATGACGG - Intronic
910887215 1:91977466-91977488 TAAAATCTAGAAAAAGATGAAGG + Intronic
911793612 1:102049430-102049452 TAAAATCTAGAAAAATATGTGGG + Intergenic
911813799 1:102316801-102316823 TAAAATCTACAGATAGATTCTGG + Intergenic
911888786 1:103340559-103340581 TGAAATCTAGAAAGAGATGCTGG + Intergenic
912000521 1:104828755-104828777 TAAAATATATAAATTAATGAAGG + Intergenic
912236109 1:107852781-107852803 TAAAATCTTAAAATTGTTTATGG - Intronic
912539759 1:110405459-110405481 TAAAATTTAAAAAAAGAGGCCGG - Intronic
913407041 1:118505909-118505931 TAAACTTTGAAAAAAGATGAGGG + Intergenic
913458799 1:119062034-119062056 TGAAATGTAAAAATAGATATTGG + Intronic
915036372 1:152929222-152929244 TATAAACTCAAAATAGATTAAGG - Intergenic
916329802 1:163602381-163602403 TGAAATCTAAATAGACATGAAGG - Intergenic
916367154 1:164043196-164043218 AAAAATCTAAAAATGAATCAGGG + Intergenic
916699688 1:167278786-167278808 TAAAATAGAAAAACAAATGAAGG - Intronic
916927082 1:169533730-169533752 CAAAGTCAAAAAATAGATGCTGG + Intronic
916974751 1:170063967-170063989 ATAAATCTAATAATAAATGATGG - Intronic
916981543 1:170143502-170143524 TAAAACTTAAAAAAAGATTATGG + Intergenic
917386166 1:174477500-174477522 CAAAGTCAACAAATAGATGATGG + Intronic
917413091 1:174780471-174780493 GATAATGTAAAAATAGAGGAAGG - Intronic
917745430 1:178002150-178002172 TAAAATGTAAAAATATTTGACGG + Intergenic
917830882 1:178884435-178884457 TATATTCTAAAAATATTTGATGG + Intronic
917907557 1:179602211-179602233 AAAAATCAAAAAACAGATGTTGG - Intronic
918594527 1:186277617-186277639 TACAATCTAAAATTAGATAGTGG + Intergenic
918601060 1:186362382-186362404 TAAAAACAAAAAATAGAGCAGGG + Intronic
918788663 1:188797698-188797720 AAAAATCAAAAAGTAGGTGAAGG + Intergenic
918894311 1:190319940-190319962 TAAATTTTAAAAATAGAAAATGG + Intronic
918941125 1:190999186-190999208 TTATATCTAATAATAGATTATGG - Intergenic
919561320 1:199123503-199123525 TAAAATATTAAAATATGTGATGG + Intergenic
920042377 1:203110005-203110027 TAAAATGTCAAAACAGATGTTGG + Intronic
920770307 1:208878448-208878470 TTAAATAGAAAGATAGATGATGG - Intergenic
920905237 1:210157780-210157802 TAAAATTAAAAAATAAAGGAGGG + Intronic
921229119 1:213051031-213051053 TAAAATCTCATAAAAGGTGACGG + Intergenic
921278960 1:213546514-213546536 TAAAATGTAATAATATATGTTGG - Intergenic
921449774 1:215291482-215291504 AAAAATCTAAAAATACATTTTGG + Intergenic
921561275 1:216661337-216661359 TAACATGTAAAAATTGATGTTGG - Intronic
921643532 1:217584982-217585004 TATAAACTAAAGAAAGATGAGGG + Intronic
921781085 1:219164975-219164997 TAAAATCTAAAAACATTTAAAGG - Intergenic
921784085 1:219205644-219205666 TTAAAAATAAAAATAAATGAAGG + Intronic
921852430 1:219945482-219945504 CAAAAACTAGAAATAAATGAAGG + Intronic
922270314 1:224026804-224026826 GAAAACATAAAAATAAATGATGG + Intergenic
922367177 1:224877004-224877026 AAAAATTAAAAAATAGATGTTGG + Intergenic
922390155 1:225132879-225132901 AAAAGTCAAAAAATAGATGCTGG - Intronic
922400390 1:225248084-225248106 TAATATCTTCAAATGGATGAAGG + Intronic
923973763 1:239235966-239235988 AAAAATATATAAATAGTTGAGGG - Intergenic
924467890 1:244314595-244314617 TACAATAAAAAAATAGAGGATGG - Intergenic
1063261687 10:4396379-4396401 TTAAATTTAATAATACATGATGG + Intergenic
1063400255 10:5736891-5736913 TAACATCTAGTAATAGATGAGGG - Intronic
1063529172 10:6814184-6814206 TAAAATATAAAAATACAAGTAGG - Intergenic
1064233160 10:13547846-13547868 TACAATGTAAAAATAGCAGAAGG + Intergenic
1064521478 10:16207415-16207437 AAAAATCAAAAAACAGATGTTGG - Intergenic
1064797913 10:19034637-19034659 AAAAATCATAATATAGATGAGGG - Intergenic
1064808586 10:19166716-19166738 TAAAATATAATAATAAAAGAAGG + Intronic
1065019257 10:21489448-21489470 AAATAGCTAAAAGTAGATGAAGG - Intergenic
1065165430 10:22971735-22971757 AAAAAATTAAAAATAGAGGACGG - Intronic
1066017035 10:31257722-31257744 TAAAAAAAAAAAATAGATGTTGG - Intergenic
1066095388 10:32067367-32067389 AAAAATACAAAAATATATGAGGG - Intergenic
1066246643 10:33590087-33590109 TAAAATCTAACCATGGATTATGG - Intergenic
1066399969 10:35066826-35066848 TAAAATCTAAGAAAGAATGATGG + Intronic
1066651475 10:37660373-37660395 AAAAATCAAAAAATAGATGTTGG + Intergenic
1067034971 10:42908050-42908072 CATAATCAAAAAATAGATGTTGG + Intergenic
1067381722 10:45779990-45780012 AAAAAAAAAAAAATAGATGATGG + Intronic
1067555692 10:47268402-47268424 TAAAATCCATAAATCTATGAAGG + Intergenic
1067889421 10:50120627-50120649 AAAAAAAAAAAAATAGATGATGG + Intronic
1068331526 10:55577298-55577320 TAAAATCTGAAAATAAATTTTGG - Intronic
1068390733 10:56393033-56393055 TAAATTTTAAAAATATATAATGG + Intergenic
1068458930 10:57300429-57300451 TACAAACTCAAAATAGATCAAGG + Intergenic
1068575050 10:58675811-58675833 TAAAATTTAAAAAGACATGAGGG + Intronic
1069489094 10:68846032-68846054 TTAAATCTCAAAATAGAGGTGGG - Intronic
1069767668 10:70875377-70875399 TAAAACAAAAAAATAAATGAAGG - Intronic
1070217860 10:74405459-74405481 TAAAATCTAAAAAAAAAGAATGG - Intronic
1071417592 10:85455561-85455583 CAATATCGAAAAATAGAAGAGGG + Intergenic
1071577153 10:86736699-86736721 ACAATTTTAAAAATAGATGATGG + Intergenic
1071699385 10:87913910-87913932 AAAAATCAAAAAATAAATGCTGG - Intronic
1071766586 10:88672853-88672875 TAAAATCTAAAATTTTTTGATGG + Intronic
1071879672 10:89882814-89882836 TCAAATCTAAAAACAGACAATGG - Intergenic
1072225732 10:93367233-93367255 TAGAATCTATAAATCTATGACGG + Intronic
1072225938 10:93368693-93368715 TAAAAAGTAAAAATAAAAGAGGG + Intronic
1072517255 10:96197512-96197534 TAAAATTTAGAAATATGTGAAGG + Intronic
1073849658 10:107599939-107599961 GAAACTCTAAAGATAAATGAAGG + Intergenic
1074498423 10:114000450-114000472 TAAAATTTAAATTTAAATGAGGG - Intergenic
1074633976 10:115292388-115292410 AAAAATCCAAAATTAGAAGAAGG - Intronic
1074723728 10:116286176-116286198 GAAATGATAAAAATAGATGAGGG + Intergenic
1075653557 10:124146331-124146353 TAAAGTCTAAAAATAGTTACAGG - Intergenic
1076044477 10:127280332-127280354 TACAACATAAAAATATATGAAGG - Intronic
1076506380 10:130975877-130975899 GAAAATATAAAATTAGATTATGG - Intergenic
1076578886 10:131493689-131493711 TAACAACTAAAAATAGATGCTGG - Intergenic
1077574084 11:3366510-3366532 TTTGATTTAAAAATAGATGAAGG + Intronic
1077828372 11:5835556-5835578 TATAATTTAAAAAAAGATGGGGG - Intronic
1077959999 11:7065815-7065837 GAAAAACTTAATATAGATGATGG - Intronic
1078140122 11:8686234-8686256 TAAAAAAAAAAAAAAGATGAGGG - Exonic
1078244342 11:9560242-9560264 TCAAATCTAAAAATATACAATGG - Intergenic
1078538624 11:12195588-12195610 GAAAATATAAAAGTAGATGCTGG + Intronic
1078675197 11:13405532-13405554 TAATTTATAAAAATAGGTGATGG + Intronic
1078955792 11:16193376-16193398 AAAAAAATAAAAATAAATGAAGG + Intronic
1079105216 11:17567436-17567458 TAAAGTCTAAAAATATTTCAAGG + Intronic
1079165560 11:18038790-18038812 TTAAATTTAAAAAAAGCTGATGG + Intronic
1079496690 11:21052404-21052426 AAAAATCCAAGAAGAGATGATGG + Intronic
1079503499 11:21128918-21128940 TAAATCCTAAAAATAGATAGAGG - Intronic
1079813956 11:25031864-25031886 TAAAATTTACAAATATATGGTGG + Intronic
1079816820 11:25071407-25071429 TAAAAAATAAAAATAAATGTAGG + Intronic
1080078950 11:28190731-28190753 TAAATTATAATGATAGATGAGGG + Intronic
1080243801 11:30157008-30157030 TAAAATATCAATTTAGATGATGG - Intergenic
1080493208 11:32789975-32789997 TAAAATGAAAAATTAGATAAGGG + Intronic
1080526143 11:33121680-33121702 TAAAATGTAAAGACAGTTGAAGG + Intronic
1080644281 11:34176935-34176957 TGAAATCTAAAAATATTTGGGGG - Intronic
1080673310 11:34401130-34401152 TAAATTTTAAAAATAGACTATGG - Intergenic
1080692377 11:34569244-34569266 TAAAATCTGGAGATAGATGGTGG - Intergenic
1080959262 11:37139081-37139103 AAAAGTCTAAAAACAGATGCTGG + Intergenic
1081425719 11:42924555-42924577 TTGAATGTAAACATAGATGAAGG - Intergenic
1081459987 11:43263625-43263647 TAAGATCAAAATATAGAGGAGGG + Intergenic
1082655448 11:55850805-55850827 TAAAATTTAAATACAGATTAAGG + Intergenic
1082912490 11:58392189-58392211 CAAAAACTTAAGATAGATGATGG - Intergenic
1083250672 11:61464524-61464546 TAAAATAAATAAATAAATGATGG - Intronic
1085223672 11:74898245-74898267 TCAAATCAAAAAATATACGATGG + Intronic
1085325987 11:75606910-75606932 CTAAATCTAGAGATAGATGAGGG - Intronic
1085438568 11:76534816-76534838 TATAATCTGAATATAGAGGAAGG + Intronic
1085886298 11:80526205-80526227 AAAAGTCAAAAAATAGATGTTGG + Intergenic
1085919039 11:80929497-80929519 TAGAATTTAAAAATAGATCAGGG - Intergenic
1085964628 11:81507119-81507141 AAAAAACTAAAAATAGATACTGG - Intergenic
1085976936 11:81667679-81667701 AAAAATTAAAAAATAGTTGAAGG - Intergenic
1086245545 11:84747719-84747741 TAAAATCTAAAAATATTTTATGG + Intronic
1086285572 11:85245929-85245951 CAAAATCTTAAAAGAGGTGAAGG - Intronic
1086473713 11:87146610-87146632 TCAAATGTAAAAATATGTGATGG - Intronic
1086513420 11:87585500-87585522 AAACATCAAAAAATAGATGTTGG - Intergenic
1086677976 11:89633169-89633191 GAAAATCTAAAAATCTATCAAGG + Intergenic
1087370041 11:97272448-97272470 TAAAACCTAAAATTGGAAGATGG + Intergenic
1087536547 11:99454245-99454267 TAAAATAATAAAATAGATAAAGG + Intronic
1087836847 11:102883709-102883731 TAAAAAATAAATAGAGATGAGGG - Intergenic
1087894086 11:103568414-103568436 AAAAATAAAAAAATAGATGTTGG - Intergenic
1088094454 11:106082019-106082041 TAAAAAAGAAAAATAAATGATGG + Intronic
1088268973 11:108014512-108014534 TAAAAGCCAAAAATAGATTGAGG - Intronic
1089485453 11:118842205-118842227 AAAAATCTAATAATATATTATGG - Intergenic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1091643908 12:2258961-2258983 CAAATTCCAAAAATAGATGAGGG + Intronic
1092701557 12:11236978-11237000 TAAAATTTAAAAATAAATAGAGG - Intergenic
1092942288 12:13421036-13421058 CAAAAACTTGAAATAGATGAGGG - Intergenic
1093007383 12:14064951-14064973 AAAAAAAAAAAAATAGATGAAGG + Intergenic
1093294354 12:17369530-17369552 TAACATATATAAATAGATAAAGG + Intergenic
1093459314 12:19394083-19394105 TAAAATTTAAAAATAGGCCAGGG + Intergenic
1093859832 12:24151116-24151138 GTAAATGTCAAAATAGATGAAGG + Intergenic
1094117418 12:26932194-26932216 GAATATATAAAAATGGATGAAGG + Intronic
1094711488 12:32967795-32967817 AAAAATCTAACAATAGGGGATGG - Intergenic
1095050287 12:37548160-37548182 TAAAAAATAATAATAAATGATGG - Intergenic
1095233812 12:39773536-39773558 GAAACTCTAAAGATAAATGATGG - Intronic
1095257978 12:40063026-40063048 TAACTTGTAAAAATAGATGCTGG - Intronic
1095711323 12:45291442-45291464 AAAAAATTAAAAATAGATAACGG + Intronic
1096796809 12:54082868-54082890 TAAAATAAAAAAAAAGAAGAAGG - Intergenic
1096925639 12:55142017-55142039 GAAAATGTAAATACAGATGAAGG + Intergenic
1097667001 12:62490257-62490279 TAAAACATAAAAATAGGTTACGG - Intronic
1097923510 12:65102949-65102971 TCAAGTACAAAAATAGATGATGG + Intronic
1098627539 12:72691002-72691024 TAAAATCTTCAAACAGATGCAGG + Intergenic
1098985870 12:77011410-77011432 TGTAATTTAAAAATAGCTGATGG - Intergenic
1098996937 12:77131293-77131315 TAAAATCTAAATAAGGTTGATGG - Intergenic
1099245214 12:80186081-80186103 TAAAAGATAAAAATATAGGAAGG - Intergenic
1099296919 12:80839792-80839814 TAAAATGTAAAAAAAGCCGATGG + Intronic
1099472265 12:83065900-83065922 TAAACTCTAGAATTAGAAGAGGG + Intronic
1099497239 12:83364388-83364410 AAAACTATAAAAATTGATGAAGG - Intergenic
1099532278 12:83799044-83799066 TAAAATATAAATGTATATGAAGG + Intergenic
1099551776 12:84054642-84054664 TAAACAATAAAAATTGATGAAGG - Intergenic
1099574950 12:84366638-84366660 TAAAATGTAAACATAAATTATGG + Intergenic
1099867092 12:88296467-88296489 TCAAATCTCTAAAAAGATGAGGG - Intergenic
1099868249 12:88312272-88312294 TTAAATTAATAAATAGATGAAGG - Intergenic
1100083909 12:90883866-90883888 TAATATGGAAAAATATATGAGGG + Intergenic
1100098809 12:91077103-91077125 TCAACTCTAAACATAGAGGAAGG + Intergenic
1100337793 12:93648397-93648419 TAAAAATTAAAAAAAAATGAAGG - Intergenic
1100467219 12:94856894-94856916 AAACATCTAAAAATAAAGGATGG + Intergenic
1101337808 12:103811669-103811691 TAAAAACCAAAAATATGTGAAGG + Intronic
1101607811 12:106261438-106261460 TCAAATCTAAAAATATACAATGG + Intronic
1102128503 12:110505450-110505472 TAAAATAAAAAAATAGAGGTGGG + Intronic
1102415636 12:112760122-112760144 TAAAATCTAGAAACTGATGTGGG - Intronic
1102944598 12:116974900-116974922 TAAAATAAATAAAAAGATGAAGG + Intronic
1103314161 12:120038957-120038979 TAGATTCTTAAAATACATGAAGG + Intronic
1103372725 12:120431904-120431926 TAAAATATAAAAATAAATCCAGG - Intergenic
1103714212 12:122934396-122934418 AAAAATCTAAAAATACAGGCTGG + Intronic
1104226866 12:126843511-126843533 AAAAATCAACAAATAGATGGAGG - Intergenic
1104611232 12:130229403-130229425 TAACATGAAAAAATAGAAGAGGG + Intergenic
1104737276 12:131143436-131143458 TAAAGGCTAAAAATAGACGCTGG - Intergenic
1104938334 12:132379329-132379351 TAGAAAATAAAAATACATGATGG + Intergenic
1105485560 13:20827873-20827895 AAAAACCTACAAATATATGATGG - Intronic
1106358622 13:29009072-29009094 TAAAATGTAAAAATCAAAGAAGG - Intronic
1106500298 13:30322015-30322037 TAAAATCTAAAAATAATTAGAGG - Intergenic
1108088856 13:46824585-46824607 AAAACTCTAAGAATAAATGAGGG - Intergenic
1108353714 13:49610938-49610960 TAAAGTTTAAAAATACATAAAGG + Intergenic
1108526759 13:51292113-51292135 TAAAATTTAAAAAGAGGTAAGGG - Intergenic
1108974156 13:56417174-56417196 TATAATTTAAATATTGATGAAGG + Intergenic
1109052625 13:57504163-57504185 AAAAAATTAAAAATAGATGTTGG - Intergenic
1109402248 13:61849212-61849234 CAAAAACTAAATATAGAGGAAGG + Intergenic
1109837955 13:67883522-67883544 TAAAATATAATAATAGAAGAAGG + Intergenic
1110088426 13:71412332-71412354 TAAAAAAAAAAAAAAGATGATGG - Intergenic
1110325153 13:74205515-74205537 TATTATCTAAAAATTGATGTTGG + Intergenic
1110483391 13:76010229-76010251 TGAATTCTAAAAATAGAAAAAGG + Intergenic
1110490933 13:76106119-76106141 TAATAACTAAATATAGATTATGG - Intergenic
1110577107 13:77070175-77070197 TAAAATCTTTAAAATGATGAAGG + Intronic
1111055421 13:82943007-82943029 GAAAATCTGAAAATATTTGAAGG + Intergenic
1111071883 13:83180427-83180449 TAAAATTTCAAAATAAATTAAGG - Intergenic
1111166229 13:84461307-84461329 TAATAACTAAAAAGAGATTATGG - Intergenic
1111226037 13:85272247-85272269 AAAAATCAAAAAATAATTGATGG + Intergenic
1111266882 13:85827082-85827104 TAAAATCTAACAATACATACTGG - Intergenic
1111514773 13:89314671-89314693 TAAAATCTAAATATATAGAAAGG + Intergenic
1112029571 13:95444733-95444755 CAAAAACAAAAAATAGATGAGGG - Intronic
1112114556 13:96338012-96338034 TCACATCTAAAAATAGAAAAAGG - Intronic
1112585323 13:100714021-100714043 TAAAACTTAAAAATGGATAATGG - Intergenic
1112706330 13:102073282-102073304 TAAATTGTAATAAAAGATGATGG + Intronic
1114395458 14:22354995-22355017 TAAAGTATAAAAAAAAATGAAGG + Intergenic
1114698669 14:24653335-24653357 TGAAATTTAAAAATAAAGGAAGG + Intergenic
1114814436 14:25940419-25940441 GAAAATCTAAGCAAAGATGAAGG + Intergenic
1115647464 14:35379164-35379186 TAAAATCTAAAGACAAATGAAGG + Intergenic
1115765530 14:36619170-36619192 TAAAATTTAAAAATATCTAAAGG - Intergenic
1115807416 14:37066949-37066971 AACAATCTAGACATAGATGAGGG + Intronic
1115975021 14:38987676-38987698 AAAAAACAAAAACTAGATGAGGG + Intergenic
1116189226 14:41641745-41641767 TAAAATATTTAGATAGATGAAGG + Intronic
1116300273 14:43171306-43171328 GAAAATGTAGAAATACATGATGG + Intergenic
1116484473 14:45430615-45430637 GAAAATCAAAAAACAGATGCTGG - Intergenic
1116497494 14:45580088-45580110 GAAAATCCACAAATAAATGATGG - Intergenic
1116675437 14:47901163-47901185 TAACATTTAAAAATTTATGAAGG + Intergenic
1116678218 14:47933195-47933217 TAAAATATACACATAGATCATGG + Intergenic
1116787245 14:49301138-49301160 TAAAATTGCAAAATAGATGAGGG - Intergenic
1116911295 14:50467854-50467876 TACAAGCAAAAAATAGATTAAGG - Intronic
1117501558 14:56357444-56357466 TTAAATCTAAAAATAGTTCTTGG - Intergenic
1118031367 14:61821259-61821281 TAAAATCTAACAATTGATTTGGG - Intergenic
1118125758 14:62901881-62901903 TAAAAAGTAAAAATAGATGCTGG - Intronic
1118634623 14:67736212-67736234 TAAATTCTAAAAATAGGAAATGG - Intronic
1118690400 14:68333245-68333267 AAAAATAGAAAAATAGACGAGGG + Intronic
1119592870 14:75906467-75906489 TAAAATCTGAAACTAGGTTAAGG - Intronic
1120029849 14:79628952-79628974 TAAAATCAAAACATATCTGATGG - Intronic
1120331703 14:83101623-83101645 TATATTCTAAAAGTAGATTATGG - Intergenic
1120471749 14:84934242-84934264 AAAAAACAAAAAATAGATGTTGG - Intergenic
1120528319 14:85603495-85603517 TAACTTCTGATAATAGATGATGG + Intronic
1120596692 14:86448276-86448298 TAGAATATAAATTTAGATGAGGG + Intergenic
1120791484 14:88587771-88587793 TAAAATATATATATAGATGAGGG - Intronic
1120819455 14:88898759-88898781 TAAAATCTCAAAATCGAGGTAGG + Intergenic
1120977269 14:90260018-90260040 TACCACCTGAAAATAGATGATGG + Intronic
1121334943 14:93071649-93071671 TGTAATTTAAAAATGGATGATGG - Intronic
1123184207 14:106499079-106499101 AAAAATAAAAAAATAGATGTTGG - Intergenic
1124400119 15:29340723-29340745 GAAAAAATAAAAATAGATAATGG + Intronic
1124562336 15:30786475-30786497 TAAAATTTAAAAATAAATAAAGG - Intergenic
1124810304 15:32930279-32930301 AAAAATTTAAAAATAGACCAGGG - Intronic
1125119999 15:36144921-36144943 TAAAATCTAAAGCAAGATGAAGG - Intergenic
1125130113 15:36274710-36274732 TAAAATCTAAATATGAATGTTGG + Intergenic
1125789406 15:42352196-42352218 AAAAATCTCAAAAAAGGTGAGGG - Exonic
1126269938 15:46803537-46803559 TACAATCTAAAAGTAAATGAAGG + Intergenic
1126460341 15:48908204-48908226 AAAAATCAAAAAACAGATGTTGG - Intronic
1126743557 15:51802076-51802098 TCAAATCCAAAAAAAGATGCAGG + Intronic
1126804156 15:52329026-52329048 TAAAATAAACAAATATATGATGG - Intronic
1126898925 15:53291215-53291237 TAAAAACTAAAAATATTTTAAGG + Intergenic
1126933377 15:53679331-53679353 TAAAATATAAACAAAGATGTGGG - Intronic
1127014919 15:54673804-54673826 CAAAGTCAAAAAATAGATGGTGG + Intergenic
1127108450 15:55642790-55642812 AAAAATCTAAAAATAGAGGATGG + Intronic
1127206669 15:56727609-56727631 TGAAAACTAGAAACAGATGAAGG - Intronic
1127505944 15:59597810-59597832 AAAAATAAAAAAATAGATGTTGG - Intronic
1127544232 15:59975418-59975440 TAAAAAGTTAAAATATATGATGG + Intergenic
1127766653 15:62191964-62191986 TAAAATATTAAAATATATAATGG - Intergenic
1127800772 15:62475657-62475679 GAAAATCTAAAAATTGTAGAGGG - Intronic
1127925327 15:63534522-63534544 TAAAATCCAAAACTAGATGAGGG + Intronic
1128731883 15:70026800-70026822 TAAAATATAAGAAAACATGAGGG + Intergenic
1128955010 15:71931700-71931722 TAAATTCAAAAAATACCTGAAGG - Intronic
1128963572 15:72034449-72034471 TATAATCTAAACATTCATGAGGG - Intronic
1129046748 15:72742254-72742276 AAAAATCAAAATATAGATGTTGG + Intergenic
1129064709 15:72891717-72891739 TAAAAAATAAAAATAGAATAAGG + Intergenic
1129785567 15:78307929-78307951 ACAAATATAAAAATAGAAGAGGG + Intergenic
1129937788 15:79465082-79465104 TAAAAATTAAAAATAGATATTGG + Intronic
1129990753 15:79960279-79960301 TAAAATTAAAAAAAAGAGGAAGG + Intergenic
1130713296 15:86305528-86305550 TGAAATATAAAAATAGTTGGAGG - Intronic
1131103212 15:89710562-89710584 TAAAATTTAAATATAGGTAAAGG - Intronic
1131746093 15:95449240-95449262 TAAAAGCTTATAATAAATGAAGG - Intergenic
1132077835 15:98837528-98837550 AAAAATTTAAAAATTGGTGAAGG - Intronic
1132182953 15:99775720-99775742 AATATTCTAAAAATAGATTATGG - Intergenic
1132257447 15:100388439-100388461 GAAAATAAAAAAATAGATGGGGG + Intergenic
1133464279 16:6015162-6015184 TAAGATCTAAAAATCTAAGAAGG - Intergenic
1133594548 16:7279009-7279031 TAAAATCTAAAAACTGATGACGG + Intronic
1133824432 16:9264725-9264747 TAAAACGTAAAAATATAGGAAGG - Intergenic
1134277628 16:12791039-12791061 TAAAAAAAAAAAAAAGATGATGG - Intronic
1134332962 16:13267053-13267075 TAAAATCACAAAATAAAAGATGG + Intergenic
1135536412 16:23297808-23297830 TAAGATCAAAATACAGATGAGGG + Intronic
1135808544 16:25566602-25566624 TAAAAAATAAAAATAAAAGAAGG - Intergenic
1135813708 16:25612656-25612678 CAAAATCTGAAAATTTATGAGGG - Intergenic
1135837996 16:25845206-25845228 TAAAAATTAAAAATAAATGTAGG + Intronic
1135937680 16:26795098-26795120 TAAAATATGAAAGTACATGAGGG + Intergenic
1137299697 16:47136925-47136947 TAAAAACTAATAATAAATGGGGG + Intronic
1137911398 16:52381836-52381858 TAAAATTTAAAAAAAGATATGGG + Intergenic
1138023971 16:53508217-53508239 TAAAATATTAGAATAAATGATGG - Intergenic
1138072184 16:54003339-54003361 TAAAATATAATAACAGATGTTGG - Intronic
1138777162 16:59736957-59736979 TGAGATCTAAAAACAGAAGATGG - Intronic
1138999962 16:62498020-62498042 AAAAAAATAAAAATAAATGAGGG - Intergenic
1139075314 16:63439839-63439861 TTAAATGTAAACATAGTTGATGG + Intergenic
1139814740 16:69659463-69659485 TAAAATCTGAACATAAATAATGG - Intronic
1140710574 16:77673556-77673578 TAAAATGTAAAAATCCATAAAGG + Intergenic
1140762418 16:78122328-78122350 TAAAATCTAAACCTACATGCAGG - Intronic
1140781598 16:78301934-78301956 AACATTCTAAAATTAGATGAGGG + Intronic
1140969265 16:79997306-79997328 AAAAATGTAAAAATAAATAAAGG + Intergenic
1141308797 16:82893299-82893321 AGAAATCCAAAAATAGATAAAGG + Intronic
1141322307 16:83022996-83023018 TACCATCTAAAAATGGATAAGGG - Intronic
1141993847 16:87624774-87624796 TAAAAACTAAAAAAAGCTGTGGG - Intronic
1142320649 16:89380663-89380685 GAAACTCTAGAAATAAATGAAGG + Intronic
1142844490 17:2662306-2662328 TAAAATCAAAACTGAGATGAAGG - Intronic
1143162387 17:4880112-4880134 TAAAAACTCAAGACAGATGAGGG - Intronic
1143991369 17:10965733-10965755 TAAATTTTAAATATAGATGTTGG + Intergenic
1144254338 17:13451448-13451470 TAAAAAAAAAAAATAGATGTTGG + Intergenic
1144701187 17:17341705-17341727 TAAGAGGTAAAAATAGAAGAGGG - Intronic
1145409021 17:22639472-22639494 TATATTCCAAAAATAAATGAGGG - Intergenic
1147233464 17:39037579-39037601 CAAAATCTAAATATAGACTAAGG - Intergenic
1147235255 17:39052323-39052345 AAAAATCGAAAAACAGATGTTGG + Intergenic
1147870594 17:43584512-43584534 TAAAATTAAAAAGTAGGTGATGG - Intergenic
1149548831 17:57524697-57524719 TAAAATCCTAAAAATGATGATGG - Intronic
1149621890 17:58051547-58051569 TAAGATCTAGCATTAGATGATGG - Intergenic
1149683309 17:58520437-58520459 CAAAATACAAAAACAGATGAAGG - Exonic
1150050312 17:61955927-61955949 TAAAATATAAAAATAGTTAATGG + Intronic
1150570821 17:66385564-66385586 TAAAAATTAAAAATAGATCCTGG + Intronic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1151594284 17:75067556-75067578 TTAAATCTAAAAATAAAATAAGG + Intergenic
1151695080 17:75710850-75710872 TAAAAAATAATAATAGAAGAAGG + Intergenic
1151777589 17:76217157-76217179 AACAAACAAAAAATAGATGAAGG - Intronic
1151837520 17:76593013-76593035 AAAAATACAAAAATAGCTGAGGG - Intergenic
1151937066 17:77268791-77268813 TAAAACATAAAAATACAGGAAGG - Intergenic
1152096389 17:78274365-78274387 TAAAAACTAAAAACAAATAAGGG - Intergenic
1153143920 18:2006812-2006834 TAAAATATAAATAAATATGAAGG + Intergenic
1153211932 18:2776749-2776771 ATAAATCTAAAAATAGATTGAGG + Intronic
1153959586 18:10129630-10129652 TGAACTGTAAAAATAAATGAAGG + Intergenic
1154928346 18:20963653-20963675 GAGAATGTAGAAATAGATGATGG - Intronic
1154967946 18:21378367-21378389 TAAAAAATAAAAATAAATAATGG - Intronic
1155181003 18:23346418-23346440 GAAACTATAAAAATAGTTGAAGG - Intronic
1155510619 18:26572808-26572830 TAAAATCTCAAGATAGTTGCAGG + Intronic
1155557445 18:27035837-27035859 TAAAATTTAAAATTTGCTGAGGG + Intronic
1155653486 18:28169695-28169717 GAAAATCTAAGAACAGATCATGG + Intronic
1155823114 18:30403263-30403285 TGAAATATAAAAACAAATGATGG - Intergenic
1155903938 18:31426700-31426722 GAAAATCTGAAAATTGAGGAAGG - Intergenic
1156035648 18:32764568-32764590 AAAAATATAAAAATAGAACATGG - Intronic
1156168142 18:34449018-34449040 TAAAATGTAGAAAAAGTTGAAGG + Intergenic
1156211731 18:34951810-34951832 TAAAGTTTACACATAGATGAGGG - Intergenic
1156647018 18:39176308-39176330 TAAAATCTAAAAATTGATGGGGG - Intergenic
1156796532 18:41052997-41053019 TAAAGTTTCAAATTAGATGATGG + Intergenic
1157014589 18:43696244-43696266 AAAAATATAAAAATAAATGATGG - Intergenic
1157721450 18:49928221-49928243 AAAAATCAAAAAATAGATGTTGG + Intronic
1158207164 18:55006142-55006164 AAAAGTCTAAAATTAGATTATGG - Intergenic
1158282909 18:55847553-55847575 TAAAAACTTAGAATAGATGCAGG - Intergenic
1158402601 18:57134465-57134487 TAAAATCTCAATATAGATAGAGG + Intergenic
1158678651 18:59546615-59546637 GAAAATACAAAAATAGATCAAGG - Intronic
1158843329 18:61412080-61412102 TAAAATTAAAAGATACATGATGG + Intronic
1158884073 18:61808673-61808695 TGAAATGAAAAAATATATGACGG + Exonic
1159225932 18:65536120-65536142 TAAAAACAAAAAAAAGATGTTGG + Intergenic
1159380733 18:67654881-67654903 TAAAATCTATTAATATATGGAGG + Intergenic
1159919511 18:74214929-74214951 TAAAAGAAAAAAATAGAAGATGG - Intergenic
1160889164 19:1368233-1368255 TACTTTCTAAAAATGGATGAAGG + Intronic
1161515700 19:4695152-4695174 TTAAAGAAAAAAATAGATGAGGG + Intronic
1161652532 19:5494129-5494151 AAAAAAAAAAAAATAGATGATGG + Intergenic
1162504992 19:11078357-11078379 TAAAAAATAAAAATAAAAGAGGG - Intergenic
1163545424 19:17938587-17938609 AAAAAACAAAAAAAAGATGACGG - Intronic
1163579803 19:18131715-18131737 AAAAAATTAAAAATAAATGAAGG + Intronic
1164414703 19:28037321-28037343 TAAAATCTCCAACGAGATGAGGG - Intergenic
1164805877 19:31116210-31116232 TAAATTTTAAAAATAAATCAAGG - Intergenic
1164932430 19:32186080-32186102 TAAAAAAAAAAAAAAGATGAGGG + Intergenic
1165172406 19:33903350-33903372 TAAAATAAAAAAAAAGATTAGGG - Intergenic
1165371634 19:35411102-35411124 TAAAATAAAATAAAAGATGAGGG - Intergenic
1165979816 19:39711102-39711124 TATTATCTAAAAATCAATGAAGG + Intergenic
1166953873 19:46448693-46448715 TAAAATTTAAAAAGAAAAGAGGG + Intergenic
1168083256 19:54026048-54026070 AAAAGTATAAAAATACATGATGG + Intergenic
1168462892 19:56575265-56575287 TAAAATATATAAATACATAAAGG - Intronic
926261340 2:11265985-11266007 AAAAATCTAAAAATAGAAAAAGG - Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926950449 2:18237024-18237046 TTAATTCTAGAAATAGCTGAAGG + Intronic
927264797 2:21133524-21133546 TGAAATCTAAAAAGAGATTTAGG - Intronic
928580592 2:32703770-32703792 GAAAATCTTACAATAGATGTAGG + Intronic
928684829 2:33737968-33737990 TAAAAAATAAAAATATATCATGG - Intergenic
929275684 2:40022129-40022151 TAAAATTTAAGAAGAGATTAGGG - Intergenic
930074166 2:47392913-47392935 TAAAAAGTAAAAATAGACAAAGG - Intergenic
930198528 2:48531023-48531045 TAATATCTAAAGACAGAAGAAGG + Intronic
930333703 2:50018997-50019019 TAATAGGTAAATATAGATGAGGG + Intronic
930734159 2:54758144-54758166 TAAAATCAATAAAAAGATGAAGG - Intronic
930755828 2:54971046-54971068 TTAAATCTTAAGATAAATGAGGG + Exonic
931062991 2:58551741-58551763 AAAAGTCAAAAAATAGATGCTGG - Intergenic
931436967 2:62256058-62256080 TAAATTATAAAAATAGTTTAGGG + Intergenic
931490688 2:62743230-62743252 TAAAGCCCAAAAAAAGATGAGGG - Intronic
931570154 2:63660004-63660026 AATAATCTAAAAAGAGATAAGGG - Intronic
931808688 2:65833097-65833119 TATAATTTATAAATAGATGGAGG + Intergenic
931845296 2:66197662-66197684 AAAAATCAAAAATTAGATGTTGG + Intergenic
932070979 2:68620106-68620128 AAAAATCAAAAAACAGATGTTGG + Intronic
932186732 2:69703348-69703370 AAAAATGTAAAATTAGATAATGG - Intronic
932392282 2:71405577-71405599 TAAAAAGCAAAAATAGATAAAGG - Intronic
932529466 2:72512525-72512547 TAAAATATATCAATAGATCATGG + Intronic
932653438 2:73585280-73585302 TAAAAAATAAAAATAGATGTTGG - Intronic
933071610 2:77865148-77865170 TAAAGGCTAAGAATAGAAGAAGG - Intergenic
933141655 2:78798599-78798621 TAAAATCTCAGGATAGTTGAAGG + Intergenic
933228803 2:79782223-79782245 TAAAATATAAAAATAAAAGAAGG - Intronic
933395924 2:81731206-81731228 CAGAACCCAAAAATAGATGATGG - Intergenic
933459312 2:82560712-82560734 TAATATCTATAAAAAGATGTAGG - Intergenic
934101160 2:88654347-88654369 TAAAAACTAAACATAATTGATGG - Intergenic
935136534 2:100308325-100308347 TAAAATAAAAAAATAAAAGATGG + Intronic
935546397 2:104403986-104404008 TAAATCCTAATAATAGCTGAAGG - Intergenic
935847311 2:107180665-107180687 TACAATCTAAAGATAGTTAATGG - Intergenic
936517270 2:113189669-113189691 AAAAATCAAAAAATAGACGTTGG - Intronic
936850320 2:116888884-116888906 TGAAATCTAAAAACAGAAGTAGG - Intergenic
936967873 2:118145051-118145073 TAAAATTTAAAAATAAAAAAAGG - Intergenic
937583664 2:123520387-123520409 TAAAATTCAAAAATATATCATGG + Intergenic
937716797 2:125040887-125040909 TTAAATCTTAAAAAAGATCATGG + Intergenic
938173323 2:129102145-129102167 TATAAACTAAAGGTAGATGAAGG - Intergenic
938884614 2:135631037-135631059 GAAAATTTAAAAATATATAATGG + Intronic
939228169 2:139389709-139389731 CAAAATGTACAAATAGATGTTGG - Intergenic
939325660 2:140684748-140684770 TAAAAACTAAAAATATAAAAAGG - Intronic
939532692 2:143384410-143384432 TAGAATATAAAAATAAAAGAAGG - Intronic
939595758 2:144120502-144120524 TATAAGCTAAAATTATATGATGG + Intronic
939635563 2:144578248-144578270 GAAACTCTAAAACTAAATGAAGG + Intergenic
939746434 2:145976060-145976082 TAACATCTTAAAATACAAGATGG - Intergenic
939752774 2:146068053-146068075 AAAAATTTATAAATAGATGTAGG + Intergenic
939807902 2:146796086-146796108 TAAAATTTAAAAATATACTAGGG + Intergenic
939874952 2:147567208-147567230 TAAAAAATAAATAAAGATGAGGG - Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
940117161 2:150221565-150221587 TAAAATCTAATAAATGATAATGG - Intergenic
940349851 2:152670753-152670775 TCAAATTTAAACATAGCTGAAGG - Intronic
940483775 2:154271783-154271805 TAAAAACTAAATATTTATGAGGG + Intronic
940566873 2:155375956-155375978 TATAAACTAAAAATATATGTAGG + Intergenic
940732302 2:157406951-157406973 TAGAATTTAAAAGTATATGATGG - Intergenic
940808656 2:158217731-158217753 TAGAATTTAAAAATAGAAAAGGG + Intronic
941401591 2:165037876-165037898 TAAAAAAAAAAAATAGATGTTGG - Intergenic
941632239 2:167897218-167897240 TAATATATAAAAATAGACGAAGG - Intergenic
941839115 2:170060121-170060143 TAAAATCCTAAAATATAGGAAGG - Intronic
941982295 2:171472021-171472043 TAAAAAATAAAAATAAATCATGG + Intronic
942196398 2:173524798-173524820 GAAAATCTATAATTAGAAGATGG + Intergenic
942710540 2:178830291-178830313 TTGAATTTAAAAATAGATGCTGG - Exonic
942739351 2:179156487-179156509 TATAATCAAAAAACAGATGTTGG - Intronic
943256878 2:185605604-185605626 TAAAATCTAGAAATAGAGATGGG + Intergenic
943362712 2:186941682-186941704 TAACTTTTAAAAATAAATGATGG - Intergenic
943508833 2:188799198-188799220 TAAAATACCAAAATAAATGATGG + Intergenic
943720227 2:191196563-191196585 TAACAAGTAAAAATAGAAGAAGG + Intergenic
943894790 2:193342534-193342556 AAACATTTAAAAATAAATGAAGG - Intergenic
944195875 2:197052408-197052430 TAAAATCTAAAAATGGCTAGAGG - Intronic
945014024 2:205495716-205495738 TAAAACATAAAATGAGATGAAGG + Intronic
945416650 2:209581536-209581558 TGAAATCTAAAAAGAGAGAATGG - Intronic
945542940 2:211111218-211111240 CTAAATCTTATAATAGATGAAGG - Intergenic
945565143 2:211388766-211388788 AAAAATCTAATAAAAGATGAAGG + Intronic
945690588 2:213030006-213030028 CATAATTTAAAAATAGGTGAAGG - Intronic
946531133 2:220571562-220571584 TAAAAATTAAAAATAGAGGCTGG + Intergenic
946814565 2:223563591-223563613 TAATCACTAAACATAGATGATGG - Intergenic
948500482 2:238389414-238389436 TAAAATTTAAAAAATGAAGATGG - Intronic
948952891 2:241266098-241266120 TAACATCTAAACACAGATCAAGG + Intronic
1168937772 20:1681675-1681697 AAAAATAAAAAAATAGCTGAGGG + Intergenic
1169507175 20:6224019-6224041 AAAAATCAAAAAACAGATGTTGG + Intergenic
1169622090 20:7518699-7518721 AAAAATTTAAAAATAGATAGTGG - Intergenic
1169888456 20:10428406-10428428 TAAAATCTTGAAAATGATGAAGG - Intronic
1170761652 20:19256387-19256409 AATATTCTAAAATTAGATGATGG + Intronic
1170794876 20:19538033-19538055 TAAAATTTAAAAAAAAATGGGGG + Intronic
1170831457 20:19845557-19845579 AAAAATCAAAAAGTAGGTGAAGG - Intergenic
1171069268 20:22050624-22050646 TAAAAAATAAAAATAAATAATGG - Intergenic
1171313589 20:24166583-24166605 TCAAATATAAAAAAAGATAAAGG + Intergenic
1172515868 20:35532805-35532827 TAAAATGGGAAAATGGATGATGG + Intergenic
1172825693 20:37782886-37782908 TAAAATTTAAAAATTGATACTGG - Intronic
1172934792 20:38612245-38612267 TGAAATCTAAATATATATTAAGG - Intronic
1172994654 20:39061141-39061163 TACATGTTAAAAATAGATGAAGG - Intergenic
1173017787 20:39242035-39242057 CAAAATAGACAAATAGATGAAGG + Intergenic
1173547817 20:43912977-43912999 TAAAAACCCAAAATAAATGAAGG + Intergenic
1173568822 20:44063442-44063464 CATAATCAAAAAATAGATGTTGG + Intronic
1174435993 20:50507385-50507407 AAAAATAAAAAATTAGATGAGGG - Intergenic
1174814273 20:53673425-53673447 TAAAATTTATAAATAGAGGTGGG + Intergenic
1174981557 20:55401284-55401306 TAATATCGAAAAAGAGATCAGGG + Intergenic
1175454438 20:59100492-59100514 TAAAACAAAAAAATAGATGCTGG - Intergenic
1175614353 20:60381288-60381310 CAAACTCTTAAAATACATGAAGG + Intergenic
1176946684 21:14990611-14990633 TGAAATCTTAAAAGAGATGCTGG + Intronic
1177024822 21:15909039-15909061 TAAAAACTAAAAATGGAAAAAGG + Intergenic
1177072659 21:16529745-16529767 AAAAAAATAAAAATAAATGAAGG + Intergenic
1177230769 21:18317355-18317377 AAAAAGCTGAAAATAGATGATGG - Intronic
1177284520 21:19032460-19032482 TATAATTTAAAAATACGTGAAGG - Intergenic
1177364124 21:20112088-20112110 TAAAAAATAAAAATAGAAGTTGG - Intergenic
1177402275 21:20621393-20621415 TAAAAATTAAAAAGAGATGAAGG - Intergenic
1177432580 21:21009559-21009581 TGAAATATATAAATAAATGAGGG + Intronic
1177532954 21:22386619-22386641 TATAATCTAAAAATAAACCATGG + Intergenic
1177630108 21:23715344-23715366 TAAAATCTGGAAATAAATAAGGG + Intergenic
1177751316 21:25287655-25287677 TTAAATATAAAATTAGATTATGG + Intergenic
1177896889 21:26863740-26863762 AAAAATATAAAAAGAGAGGAAGG - Intergenic
1178560919 21:33639033-33639055 TGAGATCTAAAGATAGATAAAGG + Intronic
1178631449 21:34264782-34264804 AAAAATATAAAGATTGATGAGGG + Intergenic
1179271786 21:39857141-39857163 TCAGATCTAAAAATAGAGCAAGG + Intergenic
1180103722 21:45602988-45603010 CAAAAACTACAAAGAGATGAAGG - Intergenic
1181542673 22:23581972-23581994 AAAAATCTAGAAATGGATGGTGG - Intergenic
1181764048 22:25078538-25078560 TAAAAAATAAAAATAGATGTGGG + Intronic
1182217928 22:28734778-28734800 TAAAATTAAAAAGTAAATGATGG + Intronic
1182568402 22:31216911-31216933 TACTATATAAAAATAGATAAAGG - Intronic
1182935057 22:34213382-34213404 TAAAATATTCAAAGAGATGAGGG - Intergenic
1182959537 22:34459014-34459036 TAAAATATTATAATAGATGATGG - Intergenic
1183274641 22:36885926-36885948 TAAAATGCCAAAATAGCTGATGG - Intergenic
1183839298 22:40484775-40484797 CAAAATCTAAAAGTAGAGGCGGG + Intronic
1184926778 22:47647209-47647231 TAAAATGTAGAAAAAGTTGATGG - Intergenic
949109815 3:245888-245910 GAAGATCTAAAAATAGTGGAGGG - Intronic
949180719 3:1127739-1127761 TACAATCTAAATATAGCTGGAGG + Intronic
949244688 3:1913075-1913097 TATAAAATAAAAAAAGATGATGG + Intergenic
949911528 3:8913836-8913858 AAAATTGTAAAAATAGATCAGGG - Intronic
949978374 3:9481572-9481594 TCAGTTCTAAAGATAGATGATGG + Intergenic
950370784 3:12528415-12528437 TGGATTTTAAAAATAGATGATGG + Intronic
951070372 3:18321145-18321167 AAAAGTCTAAAAACAGATGCTGG - Intronic
951126550 3:18991309-18991331 TAAAAACTAAATATAGCTAATGG - Intergenic
951272398 3:20642874-20642896 TAAAATTATGAAATAGATGATGG + Intergenic
951382810 3:22005387-22005409 AAAAAACTAAAAATAGAATAAGG + Intronic
951475319 3:23099386-23099408 TAAAAGCTAAAAAAAGAAAATGG + Intergenic
951665418 3:25117887-25117909 TATAATCAATAAACAGATGAAGG + Intergenic
951967570 3:28404362-28404384 AAAAATCAAAAAACAGATGTTGG + Intronic
953136559 3:40187158-40187180 TATAAGCTAAAAATAGCTCAGGG + Intronic
953520952 3:43642801-43642823 TTAAATCTAAAAATATATTCTGG + Intronic
953630077 3:44606896-44606918 TAAAATTTCAAAATCAATGATGG - Intronic
954051353 3:47981251-47981273 TAATAGCTAAATATAGATAAAGG + Intronic
955100987 3:55849638-55849660 TAGAATGTAAAAATTGAAGAGGG - Intronic
955583886 3:60455311-60455333 CAAAGTCTAATAATGGATGAGGG - Intronic
957379101 3:79401456-79401478 TAATATTTAATAATAAATGAGGG + Intronic
957495750 3:80989476-80989498 TAAAATCTTTAAAGAGATGGAGG + Intergenic
957760003 3:84543198-84543220 TAAAATATAATAATAGATGTAGG - Intergenic
957849710 3:85791606-85791628 AAAAAACTGAAAATAGTTGAGGG + Intronic
958119608 3:89267775-89267797 TAAAAGCTTAGAATAAATGAAGG + Intronic
958430964 3:94040493-94040515 TAAAATCTACAAATTAATGTTGG - Intronic
958639817 3:96791700-96791722 CAAAATCTAACAATACATTAAGG - Intergenic
959228187 3:103613711-103613733 TAAGATATAAAAATATATGATGG + Intergenic
959280457 3:104331260-104331282 TATAATAGAAATATAGATGAGGG + Intergenic
959312237 3:104753893-104753915 TAAAGTTTTAAAATAGAGGAAGG - Intergenic
959358014 3:105356394-105356416 TAAAGTCAAAAAGTTGATGAAGG + Intergenic
959761073 3:109965965-109965987 TAAAAATTAAAAAAATATGAAGG - Intergenic
959854841 3:111140177-111140199 TAAACTCTAAAAATAGTGGTTGG - Intronic
959912326 3:111777834-111777856 TTACATCTAAAACTAGTTGAAGG - Intronic
960045323 3:113191884-113191906 AAAAATAAAAAAATAGATGTTGG - Intergenic
960046332 3:113202105-113202127 TAAAATTTAAAAATAGGTAAAGG - Intergenic
960338878 3:116450885-116450907 TACAATCTGAAAATAGACCAAGG + Intronic
960421734 3:117454674-117454696 TAAAATATAACACTAGAAGATGG + Intergenic
960444051 3:117725643-117725665 TAATTTCTCAAAATAGATGTTGG - Intergenic
960498042 3:118399618-118399640 TAAAATTAATAAATAAATGAAGG - Intergenic
960560987 3:119084093-119084115 AAAAGTATAAAAATAGAGGAGGG + Intronic
960891230 3:122450591-122450613 AAAAAACAAAAAATAGATGTTGG + Intronic
961408085 3:126697517-126697539 AAAATTTTAAAAAGAGATGAAGG - Intergenic
962365777 3:134779344-134779366 TAAAATAGAAAAATAAATCATGG - Intronic
962426681 3:135274953-135274975 TAAAATTTAAAAATCTATGCAGG - Intergenic
962758972 3:138491816-138491838 TCAAATCTAAAAATATACAATGG - Intergenic
963258507 3:143170075-143170097 TAAAAATAAAAAATAGGTGAAGG - Intergenic
963376348 3:144470555-144470577 GAAAATCCAAAAATAGAATATGG - Intergenic
963505989 3:146185249-146185271 AAAAAGTTAAAAATAGATCAAGG - Intergenic
964036031 3:152197704-152197726 GAAAGTCTCAAAATGGATGAAGG - Intergenic
964071324 3:152637054-152637076 TAAAATGTAAACATAGATTAAGG + Intergenic
964311439 3:155397745-155397767 AGAAAACTAAAAATAGATGAAGG - Intronic
964465802 3:156990603-156990625 TACAATAAATAAATAGATGAAGG - Intronic
964644284 3:158941928-158941950 AAAATTTTAAAAATAGATGTTGG + Intergenic
964654367 3:159050676-159050698 GAAAATATAAAAAGAGATGCAGG + Intronic
964891305 3:161539169-161539191 AAAAGTCTAAAGATGGATGATGG - Intergenic
965287820 3:166840924-166840946 AAAAAACTAAAATTAGATAATGG - Intergenic
965542804 3:169887221-169887243 TAAAGTTTAAAAATATATAAAGG + Intergenic
965698201 3:171431557-171431579 TAAAATCTAAAAATAATTTTAGG + Intronic
966068816 3:175849381-175849403 TATAATGTAAATATAGATAATGG - Intergenic
966169645 3:177064304-177064326 AAAAATTTAAAAGTAGAAGAGGG - Intronic
966447718 3:180021953-180021975 TTAACTCTTAAAATAGAAGATGG + Intronic
966602912 3:181793519-181793541 TAAAATGAATAAATAAATGAAGG + Intergenic
966654195 3:182335263-182335285 TCAAACTTAAAAATAGATTAGGG - Intergenic
967064047 3:185898591-185898613 GAAAATCTAAAAATCTATCAAGG - Intergenic
967443199 3:189533246-189533268 AAAAAACTTAAAATAGATAATGG + Intergenic
967489568 3:190074668-190074690 GAAAAACTAAAAAGAGATGGAGG + Intronic
968146297 3:196301746-196301768 TAAAATGTAAAAATAGAGTGGGG + Intronic
968274376 3:197428839-197428861 TAAAATCTATTAAATGATGAAGG - Intergenic
968343486 3:197979999-197980021 AAAACTCTGAAACTAGATGAAGG - Intronic
969090293 4:4688992-4689014 TAAAATGAAAAAAGAGACGAGGG + Intergenic
969243118 4:5914868-5914890 TCAAATCAAAAATCAGATGAAGG + Intronic
970050722 4:11912123-11912145 TAAAAAATCAGAATAGATGAAGG + Intergenic
970228546 4:13884946-13884968 TAAAATGGAAAAATAGAATATGG - Intergenic
970317442 4:14842865-14842887 AAAAATCTAAAACTGGATAATGG - Intergenic
970821277 4:20217987-20218009 TAAAAAATAAGAAAAGATGAGGG - Intergenic
970874508 4:20853978-20854000 AAAAATCAAAAAACAGATGTTGG + Intronic
971431150 4:26569226-26569248 TATAATCAAAAATTAGTTGAAGG + Intergenic
971512350 4:27442926-27442948 AAAAATTTAAGAAAAGATGAAGG - Intergenic
971829179 4:31668139-31668161 TAAACACTAAATATAGATCAAGG - Intergenic
971868248 4:32201538-32201560 AAAAATTTAAAAATAGACAAAGG - Intergenic
972264660 4:37447646-37447668 TAAAATGTAAAGAGAGATTAAGG - Exonic
972464356 4:39339565-39339587 TCAAATTTAAAAATGGGTGAAGG - Intronic
972757707 4:42066143-42066165 TTAATTTTAAAAATAGATGAAGG - Intronic
972997833 4:44904453-44904475 TAAGATTTAAAAATAGATATAGG - Intergenic
973020089 4:45193486-45193508 TAAAAGATAAAAAAAGATCATGG - Intergenic
973064527 4:45772411-45772433 TCAAATCTAATAATATAGGAAGG + Intergenic
973192779 4:47405455-47405477 TAAAATCTAAAATTTGATAGAGG - Intronic
973322768 4:48826745-48826767 GAAAAAATAAAAATGGATGAAGG - Intronic
973831046 4:54759188-54759210 TAAAATATATATATATATGATGG - Intergenic
973933875 4:55822150-55822172 TTAATTTTAAAAATACATGATGG - Intergenic
974158493 4:58105051-58105073 TAAAATATGAAAGTAAATGAAGG + Intergenic
974256551 4:59463096-59463118 CAAAATTGAAAAATAGAGGAAGG + Intergenic
974653766 4:64790882-64790904 TAAAATCTACAGAGAGAAGAAGG + Intergenic
974909354 4:68097703-68097725 TAAAAACGAAAAAAAAATGAAGG - Intronic
974951160 4:68584106-68584128 TAAAAAAAAAAAAAAGATGAAGG + Intronic
975095517 4:70452416-70452438 TGAAATCTAAAAACATATAATGG - Intronic
975809983 4:78157475-78157497 AAAAGTCAAAAAATAGATGTTGG - Intronic
976029133 4:80729902-80729924 TTAAATTTAAAAATAGATGCTGG - Intronic
976155785 4:82143409-82143431 TAAAATTTAAAAATACACTAGGG + Intergenic
976245893 4:83005640-83005662 AAAAGTCAAAAAATAGATGCTGG + Intronic
976325007 4:83761375-83761397 TAAAATTTAAAAATTGATCCTGG + Intergenic
976400243 4:84598608-84598630 AAAATTTTAAAAATAGATGATGG - Intronic
976445319 4:85124421-85124443 AAAATTCAAAAAATAGATGTTGG - Intergenic
976470210 4:85419557-85419579 TCATATATAAAAATAGATAAGGG - Intergenic
976792824 4:88898758-88898780 AAAAATAAAAAAATAGATGTTGG + Intronic
976980690 4:91223184-91223206 GAAAATGTAAAAATATATCAAGG + Intronic
977387361 4:96359236-96359258 CAAAGACTAAAAATAGATAAAGG - Intergenic
977562690 4:98548525-98548547 TAAAATTTAAAAATACATGTAGG + Intronic
977736902 4:100427658-100427680 TGAAATCTCCAAATAAATGAGGG - Intronic
978005460 4:103610447-103610469 TAAAATTTAAAAATGGATAAAGG - Intronic
978033029 4:103959145-103959167 AAAAATCAAAAAACAGATGCTGG + Intergenic
978067922 4:104428819-104428841 GAAAATGTAAAACAAGATGATGG - Intergenic
978237091 4:106472696-106472718 TAAATCCTTAAAAAAGATGAGGG - Intergenic
978887339 4:113779968-113779990 TAAAAACTAAAAATAAAAAAAGG - Intergenic
979101038 4:116614901-116614923 TAAAATTTCAAAATACATTAAGG + Intergenic
979245782 4:118502759-118502781 TAAAATCTAAAAATATAGTTTGG + Intergenic
979637159 4:122969720-122969742 GAAAATCTAAAATAAAATGAAGG - Intronic
980087939 4:128410554-128410576 CAAAATATAAAAGTAGAAGATGG - Intergenic
980409277 4:132394259-132394281 TAAAATATAAAAATATATGTTGG - Intergenic
980565784 4:134538383-134538405 TCAAATAAAAAAATAGTTGAAGG - Intergenic
980580642 4:134745766-134745788 TAAAATAAAATAATAGATGTTGG + Intergenic
980752744 4:137113280-137113302 TAAGATCTGAAAATAGACAAGGG - Intergenic
980760460 4:137226284-137226306 AAAAATTTAAAAATACAGGAGGG - Intergenic
981156710 4:141446011-141446033 TAAGCTTTAAATATAGATGAAGG + Intergenic
981505699 4:145497010-145497032 GAAAATCTGTAAATGGATGACGG - Intronic
982135206 4:152268630-152268652 TAAAAGGTAAATAAAGATGATGG + Intergenic
982423043 4:155220707-155220729 AAAAGTCTAAAATTAGATGGAGG + Intergenic
982454203 4:155588527-155588549 TAAATTCTAAAATTTGAAGATGG + Intergenic
983296094 4:165871197-165871219 TAATATTTAAAAATAAATCAGGG + Intergenic
983305059 4:165974666-165974688 TAAATTGTAAAAATAAATGCTGG - Intronic
983456451 4:167970479-167970501 TAAAATCAAAACACATATGATGG + Intergenic
983599368 4:169507879-169507901 TAAAATCTAAAAATATAAAATGG + Intronic
983776735 4:171617024-171617046 TAAAATAACAAAATAGATAAAGG - Intergenic
983830337 4:172318825-172318847 AAAAATCTAAAAATAAACTATGG + Intronic
983876945 4:172887858-172887880 TAAAAAGTAAAAATAGAGGCCGG - Intronic
985183280 4:187289001-187289023 TAAACCCTAAAAATATATGTTGG - Intergenic
985336128 4:188897027-188897049 TAAAATAAAAAATAAGATGATGG - Intergenic
986025418 5:3846002-3846024 GAAAATCCCAAAATAGAAGATGG + Intergenic
986452179 5:7877374-7877396 TAAAATAAAAAAATAAATAAAGG + Intronic
986885699 5:12232230-12232252 TAAAATGGAAAAAAAAATGATGG + Intergenic
986957686 5:13174738-13174760 TAAAATTTGTAAATCGATGATGG - Intergenic
987011918 5:13775387-13775409 GATAATCAATAAATAGATGATGG + Intronic
987029935 5:13966517-13966539 AAAAACCAAAAAATAGATGTTGG - Intergenic
987214407 5:15718339-15718361 TAATATCTAAAGAAAGATGAAGG - Intronic
987249903 5:16088755-16088777 CAAAATATACAAATAGATCATGG + Intronic
987321602 5:16775328-16775350 TAAATTTTAAAAATACATTAAGG + Intronic
987652078 5:20754907-20754929 TAAAATGTAAACATGTATGATGG - Intergenic
987794581 5:22609731-22609753 TCAACTCTAAAAAAACATGAAGG + Intronic
987801502 5:22702546-22702568 TAAAAAGTCAAAATAGATCAAGG - Intronic
988743484 5:34106574-34106596 TAAAATGTAAACATGTATGATGG + Intronic
989444106 5:41508781-41508803 TAAAATCCAAATAAAAATGAAGG + Intronic
989519626 5:42385939-42385961 TAAAAACTAAATAAACATGAAGG + Intergenic
990385874 5:55261530-55261552 CAAAATATAAAAATAGAAGGAGG + Intronic
990452821 5:55952410-55952432 TATAATGTAAAAATAAATTACGG - Intronic
991072961 5:62506370-62506392 TAAAACATGAAAATAAATGAGGG + Intronic
991109698 5:62884888-62884910 TAAAAACTACAAATAAAAGATGG + Intergenic
991131230 5:63124314-63124336 TAAAATGTAAAAACATAAGAGGG + Intergenic
991226264 5:64276688-64276710 AAAAATTTAAAAATAAATGAGGG + Intronic
991343948 5:65642900-65642922 TAAAAATTAAAAATTGATGGTGG + Intronic
991404771 5:66291102-66291124 TAAACTCTAAATATATAGGAAGG - Intergenic
991567787 5:68022568-68022590 TTAAATCTAAACTTAAATGATGG - Intergenic
991931683 5:71759182-71759204 TAAAATTTAAAAAAAAAAGATGG - Intergenic
992310129 5:75489555-75489577 AAAAATCAAAAAATGGACGATGG + Intronic
992334314 5:75749725-75749747 CAAAGTCTTAAAAAAGATGAAGG + Intergenic
992517941 5:77515224-77515246 AAAACTCTAAAAATAGAAAAAGG - Intronic
992921175 5:81522999-81523021 TAGCATCTAAAAACAGATAAAGG + Intronic
993349415 5:86829768-86829790 CAAAATCTTAAAAGAGATAAAGG - Intergenic
993364886 5:87023081-87023103 TAAAAAAAAAAAATAGATGTTGG - Intergenic
993530966 5:89025502-89025524 TAAAATCTCAAAAGAGAGAATGG + Intergenic
993845196 5:92933109-92933131 TAAAATCTAAGAATATATAAAGG - Intergenic
994017449 5:94984058-94984080 TAGAGTCTAAAAATAGATTTAGG - Intronic
994161953 5:96566663-96566685 TAAAGTCTAAAACTAAAGGAGGG + Intronic
994227359 5:97268365-97268387 TTAAATTTAAAAAAAGAGGAGGG - Intergenic
994430722 5:99656932-99656954 TTAAATTAAAAAATAGATGTTGG + Intergenic
994970348 5:106730012-106730034 TAAAAAAAAAAAATAGAAGATGG + Intergenic
995619132 5:114004037-114004059 TAAAAACTAAAAATGGGTGCTGG - Intergenic
995770020 5:115658407-115658429 TAAAATTTCAAAACATATGAGGG - Intergenic
996142392 5:119928300-119928322 AAAAATCAAAAAATAGTTGCTGG - Intergenic
996747792 5:126859732-126859754 TAAAAAATAAAAAAAGATAAAGG - Intergenic
996820423 5:127620334-127620356 TGACATCTGAAAATAGATCATGG + Intergenic
998196113 5:140073462-140073484 AAAAATCTCAAAATAGAAAAAGG + Intergenic
998941438 5:147287261-147287283 TAAAATGTAAAATAAAATGAAGG - Intronic
999363282 5:151004176-151004198 TAAAATTTAAAAAAAGAAGAAGG + Intergenic
999678104 5:154027329-154027351 TAAAACCTAAAAAGAGATGGAGG + Exonic
1000120817 5:158196330-158196352 CAAAATGTTAAAGTAGATGATGG + Intergenic
1000198033 5:158978672-158978694 TTAAGTCTAAAAACATATGAGGG + Intronic
1000889011 5:166782013-166782035 GGAAATTTAAAAATAGATCAAGG - Intergenic
1000927890 5:167215992-167216014 TAAGTTCTAAAATTAGATTATGG - Intergenic
1001466029 5:171967086-171967108 TAAAATTTGAAAATAAATCAGGG - Intronic
1001502932 5:172253193-172253215 TAAAATTTAAAAATAGTAAATGG - Intronic
1002440316 5:179261131-179261153 CAATATCTAAAAAGAGATAAAGG + Intronic
1003050523 6:2776893-2776915 TAAATTTTAAAAATAGACAAAGG - Intronic
1003559739 6:7170691-7170713 TAAAAAATAATAATAAATGAGGG - Intronic
1003597337 6:7486067-7486089 TAAAAGCTAATAATAAAAGAGGG - Intergenic
1003990121 6:11478248-11478270 AAAAGTCAAAAAATAGATGCTGG + Intergenic
1004092715 6:12521002-12521024 CAAAATATAAAAATATATTAGGG - Intergenic
1004230737 6:13830979-13831001 TACCATCTGCAAATAGATGATGG + Intergenic
1004398746 6:15269354-15269376 TAAAATGTAAAAAATGCTGAAGG - Intronic
1005013125 6:21354863-21354885 TCAACACTAAAAATAGATGGGGG + Intergenic
1005065964 6:21817824-21817846 TAAAATTAAAAGAGAGATGATGG - Intergenic
1005477714 6:26224442-26224464 TAAAATCTTGAAAAAGATGGCGG - Intergenic
1005571636 6:27151157-27151179 TCACATCTAAAAATATGTGAAGG + Intergenic
1005687027 6:28263162-28263184 TAAAATGTAAAATTCTATGATGG - Intergenic
1006754269 6:36401300-36401322 TGAAATCTAAGTATAGATCAAGG - Intronic
1007574015 6:42913157-42913179 TAAATTCTAGAGATGGATGATGG + Intergenic
1007995210 6:46300442-46300464 TAAAATTTAAAAATACACAATGG + Intronic
1008228747 6:48957390-48957412 TAACATATAAAAATAAATTATGG - Intergenic
1008316058 6:50042609-50042631 TCAACTCTAAAAATAGGTGATGG - Intergenic
1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG + Intronic
1008683044 6:53894599-53894621 TTAAATGTGAAAATAGCTGAGGG + Intronic
1008766554 6:54924038-54924060 TAGAATCTAAAAATATTTTAAGG - Intronic
1008809471 6:55477531-55477553 TAATATATATAAATAAATGATGG + Intronic
1009382097 6:63044484-63044506 GAAAATAAAAAAATAGATGCTGG - Intergenic
1009590644 6:65665111-65665133 TACAATCTAAAATTACATAATGG + Intronic
1010013466 6:71076566-71076588 TAAATGCTAAAAATAAATAATGG - Intergenic
1010034858 6:71313197-71313219 TAAACTGTAAAAACAGAGGAGGG - Intergenic
1010194439 6:73225248-73225270 TAAAAATAAAAAACAGATGAAGG + Intronic
1010383853 6:75255921-75255943 TGACTTCTAAAAATATATGACGG - Exonic
1010420444 6:75668413-75668435 TAAAAATTAAAAATATATAAAGG - Intronic
1011077830 6:83456607-83456629 AAACAACTGAAAATAGATGATGG + Intergenic
1011653061 6:89524878-89524900 TAAAAAAAAAAAATAGATGTTGG - Intronic
1012502854 6:99909062-99909084 AAAAATATAAAAATAAAAGATGG + Intergenic
1012717140 6:102689642-102689664 AAAAATTAAAAAATAGATGTTGG - Intergenic
1012821642 6:104091575-104091597 TAAAATTTAAAAAAAAAAGAAGG + Intergenic
1013813134 6:114066885-114066907 GAACAACCAAAAATAGATGAGGG - Intronic
1013845310 6:114443834-114443856 TAAAGTATTAAAAAAGATGAAGG + Intergenic
1013850883 6:114514060-114514082 TAGAATCTGTAACTAGATGACGG + Intergenic
1014090286 6:117396969-117396991 AAAAATCAAAAATTAGATGCAGG - Exonic
1014410121 6:121105414-121105436 TTAATTCTAAAGAGAGATGAAGG + Intronic
1014631087 6:123790513-123790535 TAAAATCTGGAAGTGGATGAGGG - Intergenic
1014889420 6:126824529-126824551 TAAAAAAAAAAAAAAGATGATGG + Intergenic
1014937570 6:127401816-127401838 TAAAATATGAAAGTAAATGAGGG + Intergenic
1015028022 6:128560755-128560777 TAAAGTTTAAAAATAGAAGATGG - Intergenic
1015254116 6:131158915-131158937 TAAAAAAAAAAAAAAGATGATGG + Intronic
1015270521 6:131333343-131333365 TAAAGTCTAAAGAAAGAAGAAGG - Intergenic
1016108883 6:140196418-140196440 AAAAGTCAAAAAACAGATGATGG + Intergenic
1016338939 6:143040070-143040092 TAAAATATAAAAACATAAGAGGG - Intergenic
1016396918 6:143633791-143633813 TAAAATATCAAAATCGATTATGG - Intronic
1016444953 6:144121721-144121743 TCCAATTTAAAAATAGATAAAGG - Intergenic
1016714913 6:147214269-147214291 CTAAATCTGAAAGTAGATGATGG - Intronic
1017266894 6:152456967-152456989 TAAAATCTAATAATACATTTTGG - Intronic
1017709490 6:157154447-157154469 TAAAATCAAGAAATAGAGGCTGG - Intronic
1017995317 6:159527141-159527163 AAAAATTTAAAAATATATCAGGG + Intergenic
1018206131 6:161438680-161438702 GAAAATCGAAAAATAGATGATGG + Intronic
1018406657 6:163491463-163491485 TAAAAAATAAAAAAAAATGAGGG - Intronic
1018871017 6:167782252-167782274 AAAATTATAAAAACAGATGATGG + Intergenic
1018916521 6:168135635-168135657 TAAAAAATAAAAAAAGAAGATGG - Intergenic
1019655443 7:2192067-2192089 TAAAAACTAAAATTAAATCAGGG + Intronic
1020041270 7:5003967-5003989 AAAAATATAAAATTAGATAATGG - Intronic
1020561611 7:9734835-9734857 TAAAATATAAAAATCACTGAGGG + Intergenic
1020597628 7:10228676-10228698 TTAAATATAAAAATAGATAGTGG + Intergenic
1020736220 7:11951794-11951816 AAAAATGGAAAAATAAATGAAGG + Intergenic
1021361751 7:19723153-19723175 AAAAATCTGAAAATATATTAGGG + Intronic
1021485133 7:21159058-21159080 TGAAATCTAAGCATAAATGAAGG - Intergenic
1021951213 7:25776796-25776818 TAAGATTTAAAAAAAAATGAAGG - Intergenic
1022349175 7:29550902-29550924 TAAAATGTATAAATTAATGAAGG + Intergenic
1022691909 7:32664398-32664420 TAAAATGTAAAAATAAAATAAGG + Intergenic
1022823362 7:33983224-33983246 TAAAATAAAAACATACATGAGGG - Intronic
1022919575 7:34998939-34998961 TAAAATGTAAAAATAAAATAAGG + Intronic
1023525721 7:41100738-41100760 TGAAATCTAAATATAGAAAATGG - Intergenic
1023544409 7:41302806-41302828 AAAAATATAAAAAGAAATGAGGG - Intergenic
1023646119 7:42317984-42318006 TAAAAACTAAAAACAGAAAATGG + Intergenic
1023652749 7:42388722-42388744 TAAACACTACAAATGGATGATGG - Intergenic
1024188333 7:46977884-46977906 AAAAATCTTAAAATTGTTGAAGG - Intergenic
1024402300 7:48939053-48939075 TGGTATCTAAAAACAGATGAAGG - Intergenic
1024500951 7:50105302-50105324 AAAAATCTAAAATTAGATTGTGG - Intronic
1024513721 7:50224814-50224836 CAAATTCTGAAACTAGATGATGG + Intergenic
1024546293 7:50523175-50523197 TAAAACATTAAAATAGATGTAGG - Intronic
1024637895 7:51305617-51305639 TAAAAACAAAAAATAGATTGAGG + Intronic
1024849955 7:53700962-53700984 CAAAATATAATATTAGATGATGG + Intergenic
1025067250 7:55867989-55868011 TAAAAATTAAACATAGATGCTGG - Intergenic
1026071449 7:67124529-67124551 TAAACTATATAAATAGTTGAAGG - Intronic
1026123829 7:67562069-67562091 TATAGGATAAAAATAGATGATGG - Intergenic
1026386291 7:69851666-69851688 TAAAAACTACAAATTGCTGATGG - Intronic
1026440608 7:70440415-70440437 AAAAAAATAAAAATATATGAAGG + Intronic
1027489033 7:78799338-78799360 TAAACTCTAATAATAGAAGCAGG + Intronic
1027547792 7:79551412-79551434 TAAAATCTGAAAATATAGTAAGG + Intergenic
1027587981 7:80081716-80081738 TAAAAAATAAAAATAAATGTGGG + Intergenic
1027708964 7:81573120-81573142 AAAAAGCTAAAGATAAATGAAGG - Intergenic
1027842678 7:83333618-83333640 TATAATCAGAGAATAGATGAGGG + Intergenic
1028063714 7:86353730-86353752 TAAAATATATAAATATATTAAGG + Intergenic
1028082561 7:86597148-86597170 CAAAATATAAAAATATATTAAGG + Intergenic
1028364209 7:90008326-90008348 AACAATCTATAAATACATGAAGG + Intergenic
1028442124 7:90875678-90875700 AAATATCTAAAAATAGAGAAAGG - Intronic
1028637288 7:93003821-93003843 TAAAAATTAAAAATAGCTAAAGG + Intergenic
1029778090 7:102699823-102699845 TAAAATTTAAGATTAGAGGAAGG + Intergenic
1029811823 7:103056812-103056834 TAAAAAAAAAAAATAGATGTTGG - Intronic
1030219573 7:107083359-107083381 TAATTTGCAAAAATAGATGATGG + Intronic
1030418813 7:109280904-109280926 TAAATTGTCAAAATAGAGGAGGG - Intergenic
1030885169 7:114928214-114928236 AAAAAACTAAAAACAGAGGAAGG + Intronic
1030907857 7:115208783-115208805 TGAAATCTTAAGAGAGATGAAGG + Intergenic
1030912479 7:115268517-115268539 TTATATTTAAAAACAGATGAAGG + Intergenic
1030960949 7:115921945-115921967 TCAAATTTAAAGATATATGAAGG - Intergenic
1031094974 7:117406347-117406369 TAAAATATGAAAATAGAGGATGG + Intronic
1031316418 7:120262860-120262882 TAAAATATGAAAAAAGATGGCGG - Intergenic
1031511095 7:122650529-122650551 AAAAATCTAAAAATAAATACAGG + Intronic
1031850112 7:126853282-126853304 TAACATGTAATAACAGATGATGG + Intronic
1031923599 7:127618850-127618872 TAACATCTAAAGATGGAAGAAGG - Intergenic
1032214663 7:129948653-129948675 AAAAATGTAAAAATAAATAAGGG + Intronic
1032390161 7:131550650-131550672 TAAAATAAAAAAATATATAAAGG + Intronic
1033522733 7:142178022-142178044 GAAAGTCAAAAAATAGATGTTGG - Intronic
1033648105 7:143320647-143320669 TACAATCTAGGAAGAGATGAGGG - Exonic
1034204964 7:149307406-149307428 TAAAAGTTAAAAAAAAATGAAGG + Intergenic
1034327692 7:150251560-150251582 AAAAACCTAAAGATTGATGATGG + Intronic
1034765519 7:153717869-153717891 AAAAACCTAAAGATTGATGATGG - Intergenic
1035541177 8:439577-439599 GAAAACATAAAAATAAATGATGG - Intronic
1035644477 8:1207720-1207742 AAAAATAAAAAAATAGATGTTGG - Intergenic
1035829235 8:2676551-2676573 TAAAATAAAATAATAGTTGAAGG - Intergenic
1036798152 8:11770513-11770535 TAAAATCTAAGAAATGGTGACGG - Intronic
1036944474 8:13081717-13081739 TAAGATCTAAAGAAAAATGAAGG - Intergenic
1037307737 8:17523042-17523064 AAAAATATAAACCTAGATGATGG + Intronic
1038131251 8:24733895-24733917 AAAAATCTAAAGACAAATGAAGG + Intergenic
1038750753 8:30293534-30293556 TAAAAAATAATAATAGATGTTGG + Intergenic
1039053485 8:33515187-33515209 TAAAAAATAAAAAGAAATGAAGG - Intergenic
1039340134 8:36639050-36639072 TAAAATGTTAATATAGTTGATGG - Intergenic
1039701778 8:39969576-39969598 AAAAATCTAAAACTAGAGGCTGG + Intronic
1039812150 8:41058714-41058736 CAAACTTTAAAAAGAGATGAGGG + Intergenic
1040986480 8:53299327-53299349 AAAAGTCAAAAAATAGATGCTGG - Intergenic
1041360053 8:57043306-57043328 TAACTTCTAAAAATAGATAAAGG + Intergenic
1041551509 8:59107104-59107126 TAAACTTTTAAAATAGATCAAGG + Intronic
1041558591 8:59187731-59187753 GAAAACCGATAAATAGATGAGGG + Intergenic
1041751668 8:61267451-61267473 AAAACTTTAAAAATAGTTGACGG - Intronic
1041963988 8:63652927-63652949 TATACTCTCAAAATAGATAATGG + Intergenic
1042299628 8:67263129-67263151 TAGACTCTAAAAATAGATTTAGG - Intronic
1042323014 8:67497954-67497976 TTAAATTTAAAAATAGAGGATGG - Intronic
1042503496 8:69535628-69535650 TAAAATCTTAGATAAGATGAGGG + Intronic
1042856872 8:73276706-73276728 AAAAATCTAAGAAAAGTTGATGG - Intergenic
1042860699 8:73310328-73310350 TAAAATCTTTACATAAATGAAGG - Intronic
1043002317 8:74774091-74774113 TATAATCCAAAAATAGATTGGGG - Intronic
1043085927 8:75833051-75833073 TATAATAAAAAAATAGATGTTGG + Intergenic
1043442955 8:80292502-80292524 TAAAATTTAAAACTGGATTACGG - Intergenic
1043461141 8:80461503-80461525 TAAAATATAAAGTTAGATGGGGG + Intergenic
1043628037 8:82288989-82289011 AAAAATCAAAAAACAGATGTTGG - Intergenic
1043762360 8:84083097-84083119 CAAAAACCAAAAATAGAAGAAGG - Intergenic
1043810916 8:84739037-84739059 AAAAATCTAAAATAAGATAATGG + Intronic
1043908099 8:85831172-85831194 TAACATATAAAATGAGATGATGG + Intergenic
1044073677 8:87792946-87792968 TAAAACATAAAAAGAAATGAAGG + Intergenic
1044145411 8:88707799-88707821 TAAAATATGAAAATATTTGAAGG - Intergenic
1044256125 8:90064428-90064450 TAAAATTTAAATATATATGTTGG - Intronic
1044410924 8:91881765-91881787 TAAAATTTCAAAAGAAATGAGGG + Intergenic
1044606605 8:94053507-94053529 AAAAATTTAAAAATACACGAAGG - Intergenic
1044747263 8:95382869-95382891 CAAAATCTAAAGATAGATTGGGG - Intergenic
1045198220 8:99951737-99951759 TAAAAATTAAAAAAAGGTGAAGG - Intergenic
1045800025 8:106091560-106091582 TAAAAATTAAAAATAGAAAAAGG + Intergenic
1045837268 8:106537022-106537044 GAAAGTCCAAAAATAGATGCTGG + Intronic
1046161440 8:110371541-110371563 TAAAATTCTAAAATATATGAAGG + Intergenic
1046197001 8:110878347-110878369 TAAAATGTAAAACTATATAATGG + Intergenic
1046477840 8:114771441-114771463 GAAAATATAAAAATATATTAAGG - Intergenic
1047740482 8:127802637-127802659 GAAAATCTAAAATTACATGTGGG + Intergenic
1047846952 8:128816598-128816620 CAAAACCAAAAAATAGATGTTGG - Intergenic
1048965323 8:139610636-139610658 AAAATTCTAAAAATAGATCCTGG - Intronic
1050599619 9:7237187-7237209 TAAAATTTTTAATTAGATGATGG + Intergenic
1050715440 9:8519141-8519163 TAATATTTAAAAATTGCTGAAGG + Intronic
1050789700 9:9450876-9450898 TAAAATCCAAGAAAAAATGATGG + Intronic
1050953070 9:11621859-11621881 TAAAATTTAATAATACATGCTGG - Intergenic
1051442094 9:17096208-17096230 TAAAATTTTTAAAAAGATGAGGG - Intergenic
1051607754 9:18932677-18932699 TAAAATCTGAACAAAAATGATGG - Intronic
1051690758 9:19709911-19709933 TAAAATAAAAAAAGAAATGAAGG + Intronic
1052042969 9:23761228-23761250 TAAACACTAAAAATATACGAAGG - Intronic
1052433945 9:28402161-28402183 TAAAATGACAAAATAGATAAGGG - Intronic
1053211696 9:36234657-36234679 AAAAATTTAAAGATACATGAAGG + Intronic
1053263438 9:36692306-36692328 TAAAAACTCAAAATGGATCAGGG + Intergenic
1054741839 9:68813980-68814002 TAAAACCTGTAAAAAGATGAGGG + Intronic
1054828857 9:69600854-69600876 TAAAATATAAAAATAAAATAGGG + Intronic
1055660453 9:78498252-78498274 TAACATAGAACAATAGATGATGG - Intergenic
1055662100 9:78514555-78514577 TAGAATCTAAGAATGGAAGAGGG + Intergenic
1055883238 9:81027683-81027705 CATAATATTAAAATAGATGAGGG + Intergenic
1055911673 9:81359972-81359994 GAAAATCTAAATATATATTAAGG - Intergenic
1055993069 9:82129073-82129095 TAAAATCTGAGAAGAGAAGAAGG + Intergenic
1056413006 9:86350830-86350852 TCAAATTTAAAAATATCTGAGGG + Intronic
1056555270 9:87683002-87683024 AAAAATTTAAAAGTAGATAATGG + Intronic
1056868035 9:90248038-90248060 GAAAATATAAAATAAGATGATGG - Intergenic
1057346154 9:94252543-94252565 TAAAACATAAAAGTAGAAGAAGG + Intergenic
1057417149 9:94874604-94874626 TAAAATTTAAAAAAAGAAAAAGG - Intronic
1058832144 9:108828317-108828339 TAAAAAAAAAAAATAGATGTTGG + Intergenic
1059301048 9:113313864-113313886 TAAGATCTAAGAATGGATGAAGG + Exonic
1059517087 9:114906051-114906073 TAAAATCCTAAAATACCTGATGG - Intronic
1060333817 9:122702965-122702987 TAAAATTTTAAATTAAATGATGG + Intergenic
1060362326 9:122971262-122971284 CAAACTCTAAACATACATGAAGG - Intronic
1060632839 9:125175222-125175244 CAAAAGCAAAAAATAGATGCTGG + Intronic
1060710225 9:125855556-125855578 TGACATCTAAAATTTGATGAAGG - Intronic
1061725107 9:132578198-132578220 CAAAATGTAAAAATTCATGATGG + Intergenic
1062305621 9:135905433-135905455 TAAAATCTTAAAAAACATGCAGG + Intronic
1186011711 X:5141943-5141965 TACAAGATAAAAATAGATCATGG + Intergenic
1186125478 X:6409316-6409338 TAATATATAAAAACAAATGATGG - Intergenic
1186235756 X:7507730-7507752 TGAAATCTAAAAGTAGATTCAGG - Intergenic
1186539571 X:10386741-10386763 TGAAATTTAAAGATAGATAAGGG + Intergenic
1186649806 X:11547067-11547089 GAAAACCTAAAAATAGTTTATGG + Intronic
1187010775 X:15276630-15276652 TAAAAGGTAAAGGTAGATGATGG + Intergenic
1187590990 X:20717297-20717319 CAAAATATAAAAATAGAGGAAGG - Intergenic
1187647568 X:21365177-21365199 TGAAATTTAAAAAAAGAAGATGG - Intergenic
1187679431 X:21752176-21752198 ACAAATCTAAAAATATATCAAGG + Intronic
1187709996 X:22043695-22043717 TTAAATCTAAAAACAGAGGCTGG + Intronic
1187717686 X:22119551-22119573 TAAAAAATAAAAATAAATAAAGG - Intronic
1187872516 X:23776260-23776282 CACAATTTAAAAATGGATGAAGG + Intergenic
1188405518 X:29804327-29804349 TAAAACTTAAAAATAGAATATGG - Intronic
1188801323 X:34534032-34534054 TAAATTTCAAAAATAGATAAAGG - Intergenic
1189595544 X:42561440-42561462 AAAAATTTAAAAATAAATGGGGG + Intergenic
1189737017 X:44081672-44081694 CAAAATCAAGAAATATATGATGG - Intergenic
1189778891 X:44495047-44495069 CAAAATCTAAAATAAAATGAAGG - Intergenic
1190991928 X:55560598-55560620 TAAAATTTAAAAATATATACTGG - Intergenic
1191198360 X:57749419-57749441 AAAAATCAAAAAATGGGTGAAGG + Intergenic
1191950691 X:66588710-66588732 AAAAATCAAAAATTAGATGTTGG - Intergenic
1192056137 X:67775653-67775675 TAAAGTCAAAAAATAACTGATGG + Intergenic
1192122450 X:68469545-68469567 TAAAATAAATAAATAAATGAAGG + Intergenic
1192347475 X:70322837-70322859 TATAATCAAAAAAATGATGAGGG - Intronic
1192378539 X:70589076-70589098 AAAAATTTAAAAATAGATAGTGG + Intronic
1193153791 X:78151923-78151945 TTAACTCTAAAAATAGAGTACGG + Intergenic
1193556195 X:82956536-82956558 AGAAAACTAAAAATAAATGAAGG + Intergenic
1193728555 X:85074202-85074224 TAAAATGAGAAAGTAGATGAAGG + Intronic
1193963034 X:87948650-87948672 CAAAATCAAAAATTAGTTGAAGG + Intergenic
1194195764 X:90890064-90890086 TAAAATAAAATATTAGATGAGGG + Intergenic
1194397932 X:93409034-93409056 TAAAATATAAAAATAAATTAAGG - Intergenic
1194538813 X:95144444-95144466 TAAACTTTAAAATTATATGAAGG + Intergenic
1194603404 X:95951787-95951809 AAAAAGCTAAAAATATTTGAAGG + Intergenic
1194730840 X:97452934-97452956 TAAAAGAGAAAAATATATGATGG - Intronic
1194881891 X:99262974-99262996 TAAAAGCTATAAATAGATACAGG + Intergenic
1194928455 X:99858068-99858090 TTAAAAATAAAAATATATGAGGG - Intergenic
1195211977 X:102659264-102659286 TTAAATGTAAAAATACATGTGGG - Intergenic
1195315512 X:103673739-103673761 TAAAATTTAAAAAGAGACAAGGG - Intergenic
1195383071 X:104289181-104289203 GAAAGGATAAAAATAGATGAGGG + Intergenic
1195425348 X:104723156-104723178 TAAATTTTCAAAATAGATCATGG - Intronic
1195591481 X:106633098-106633120 TAGAATATTAAAATAAATGAAGG - Intronic
1195800506 X:108703482-108703504 CAAATTTTCAAAATAGATGAAGG - Intergenic
1195847019 X:109239873-109239895 TAAAATTTAAAAAAAGGTGGGGG - Intergenic
1195886163 X:109639993-109640015 TAAAATTTAAAAAAACATTAAGG + Intronic
1196090309 X:111733809-111733831 AAATATCAAAAAATAGATGTTGG - Intronic
1196161284 X:112486391-112486413 AAAAATCAAAAAACAGATGTTGG - Intergenic
1196675245 X:118413346-118413368 AAAAATCAAAAAATAGATGTTGG - Intronic
1196770261 X:119286534-119286556 AAAAATTTAAAAGTAGTTGATGG - Intergenic
1197605977 X:128585920-128585942 TTACATTTAAAACTAGATGATGG + Intergenic
1197616831 X:128701537-128701559 TAAAATCCTGAAGTAGATGAGGG + Intergenic
1198004355 X:132477112-132477134 TAAAAACTAAAAAATGTTGAAGG - Intronic
1198048853 X:132929302-132929324 TAAAATCTAGAATTAGTTGGAGG - Intronic
1198470778 X:136944674-136944696 AAAACTTTAAAAATAGAAGATGG - Intergenic
1198495227 X:137185577-137185599 TAAAATATATTAAAAGATGAGGG + Intergenic
1198522584 X:137468172-137468194 ATAAATATAAATATAGATGAAGG + Intergenic
1198558494 X:137822608-137822630 TAAAAGGTAAAAATAAATGGAGG - Intergenic
1198606033 X:138338752-138338774 TAAAGTTTACAAATAGAAGAAGG + Intergenic
1198622316 X:138527271-138527293 AAAAATACAAAAATAGATTAAGG - Intergenic
1199118065 X:144015986-144016008 CAAAAGCTAAAAGTAGATAAGGG - Intergenic
1199118808 X:144026220-144026242 TAGAAACCAAAAATAGATTAGGG + Intergenic
1199153821 X:144523117-144523139 TGAAATCAAAAAATATATAATGG - Intergenic
1199584581 X:149400819-149400841 TAAAAAAAAAAAATAGATGTTGG + Intergenic
1199738901 X:150713421-150713443 TAAAATATAAAAGTACATTAAGG + Intronic
1201315145 Y:12637389-12637411 TGTAATTTAAAAATGGATGAAGG - Intergenic
1201349201 Y:13020668-13020690 AAAAATGTACACATAGATGAAGG - Intergenic
1201596610 Y:15677295-15677317 TAAAGTCTAAGAAAAGGTGAGGG + Intergenic
1201607103 Y:15799161-15799183 TAATATATAAAAACAAATGATGG - Intergenic
1201716753 Y:17052972-17052994 TAAACTCTAAAAGTAGGTGCAGG - Intergenic