ID: 939954441

View in Genome Browser
Species Human (GRCh38)
Location 2:148514749-148514771
Sequence AGGTGGCATGCTCTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939954441_939954446 20 Left 939954441 2:148514749-148514771 CCACAGCACAGAGCATGCCACCT 0: 1
1: 0
2: 0
3: 41
4: 347
Right 939954446 2:148514792-148514814 CAGCTCTTAGTTATTCCCCTAGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939954441 Original CRISPR AGGTGGCATGCTCTGTGCTG TGG (reversed) Intronic
902301852 1:15507555-15507577 GGCTCCCATGCTCTGTGCTGGGG - Intronic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
902886931 1:19411972-19411994 AGGAGGCATGCTCTGGACGGTGG - Intronic
903357803 1:22758814-22758836 AGGTACCAGGCTCTGTGCTGGGG - Intronic
903972269 1:27126697-27126719 ATGTGTCAGGCTCCGTGCTGAGG - Intronic
904200831 1:28818106-28818128 ACCTGGCATGCCCTGCGCTGTGG + Intronic
905234287 1:36535204-36535226 GAGTGGCTTTCTCTGTGCTGTGG + Intergenic
905410784 1:37766428-37766450 GGGCGCCATGCTCTGTGCTGCGG + Intergenic
905533189 1:38698532-38698554 GGGTGGGAAGCTCTGAGCTGGGG - Intergenic
905550444 1:38833661-38833683 TGCTGGCATGTTCTGTACTGAGG - Intergenic
907381514 1:54094693-54094715 ATGTGCCAGGCTCTGTGCTTGGG - Intronic
907708269 1:56851794-56851816 AGGTGGCAGGCACTGGGCTTGGG + Intergenic
908766552 1:67559653-67559675 AGGTGGCAGGCACTGGGCTGAGG - Intergenic
910313752 1:85858488-85858510 AGGTGGCTTTCTCTATGCTTAGG + Intronic
911499980 1:98673594-98673616 AGGTGTCAGGCACTGGGCTGGGG - Intronic
912858984 1:113196241-113196263 AAGTGCCAGGCTCTGTGCTAGGG - Intergenic
912962613 1:114209411-114209433 AGGTGCCAGTCACTGTGCTGAGG - Intergenic
913158154 1:116120657-116120679 AGGTGCCAGGCTGGGTGCTGGGG - Intronic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
915752598 1:158226272-158226294 AGGTGGAAGGCTCTGAGGTGGGG - Intergenic
915893374 1:159791990-159792012 AGAGGGCATGATGTGTGCTGAGG + Intergenic
916518554 1:165543004-165543026 AGGTGCCAGGCACTGTGCTTAGG + Intergenic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
919963423 1:202495685-202495707 AAGTGGATTGGTCTGTGCTGAGG + Intronic
920057181 1:203201323-203201345 CGGTGGCCTGCCCTGGGCTGGGG + Intergenic
920744046 1:208608765-208608787 ATGTTGCAGTCTCTGTGCTGGGG + Intergenic
920757951 1:208753082-208753104 ATGTGCCATTCTCTTTGCTGGGG + Intergenic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
921102953 1:211946689-211946711 CAGAGGCATGCTGTGTGCTGGGG + Exonic
922321845 1:224495466-224495488 AGGTGTCAGGCTAGGTGCTGGGG + Intronic
923931369 1:238701741-238701763 GGGTTGCATGCTCTGTTCTGGGG - Intergenic
924605024 1:245526623-245526645 GGGTGACATGCTCTGTGGTTTGG - Intronic
1062813418 10:482087-482109 AGTTTGGATGCTCTGTCCTGAGG - Intronic
1063313060 10:4973489-4973511 TGGGGTCATGCCCTGTGCTGAGG - Intronic
1063314933 10:4994559-4994581 TGGGGTCATGCCCTGTGCTGAGG + Intronic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1067045225 10:42981626-42981648 AGTCGGCATGCTGTGTTCTGTGG - Intergenic
1067448875 10:46369154-46369176 AGGTGGCCTTCTCGGTGCGGTGG - Exonic
1068056403 10:52017160-52017182 AGGTAGCATGCTAAGTGCTTTGG + Intronic
1068577316 10:58698739-58698761 ACGTGCCATGCTATGTGCTTTGG + Intronic
1068661663 10:59628959-59628981 AAGTGCCAAGCTCTGTGCTAAGG + Intergenic
1069605608 10:69737057-69737079 AATTAGCCTGCTCTGTGCTGAGG - Intergenic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1073011258 10:100361582-100361604 AGGAAGCATGCTATGTGGTGGGG - Exonic
1074318849 10:112382422-112382444 AGGTGCCATGCTAGGTGCAGTGG + Intronic
1075561556 10:123472405-123472427 AGGTGGCATGCAGTGGACTGTGG + Intergenic
1075744267 10:124715613-124715635 CGTGGGCAGGCTCTGTGCTGAGG - Intronic
1075922145 10:126222549-126222571 AGCTGGCGTGCTCGGTTCTGGGG - Intronic
1076167358 10:128293255-128293277 AAGGGGCATGCTCTCTGCAGAGG + Intergenic
1076269522 10:129139215-129139237 AGGTGGCAGGGACTGTGCTCTGG + Intergenic
1076271042 10:129152445-129152467 TCGTGGCATGCTCTGTGGTGGGG + Intergenic
1077043911 11:536002-536024 AGGCGGGATGCTCGGAGCTGGGG + Intronic
1077704223 11:4468542-4468564 AGCAGGCATCCTCTGTGGTGGGG - Intergenic
1077705691 11:4482962-4482984 AGCAGGCATCCTCTGTGGTGGGG - Intergenic
1078462286 11:11523367-11523389 AGCTTGCTTGCTCTGTGCAGAGG + Intronic
1079492882 11:21009343-21009365 AGATGGCATGCAAAGTGCTGAGG + Intronic
1079896079 11:26119867-26119889 AAGTGACATGCTGTGTGCTGTGG - Intergenic
1080048857 11:27837949-27837971 AGGTATCATGCTGGGTGCTGAGG + Intergenic
1080638726 11:34145905-34145927 AGGGGGCAGGCATTGTGCTGGGG - Intronic
1080791716 11:35527350-35527372 ATGTGGTAGGCTCTGTGCTATGG - Intronic
1081581729 11:44356726-44356748 AACTGACTTGCTCTGTGCTGAGG + Intergenic
1081737550 11:45414491-45414513 AAATGCCAGGCTCTGTGCTGAGG + Intergenic
1082773465 11:57227665-57227687 TGGTTGCAAGCTCTGTACTGGGG - Intergenic
1083672688 11:64307829-64307851 AGGGGACATGTTCTATGCTGGGG - Intronic
1085043273 11:73339234-73339256 AGATGCCAAGCACTGTGCTGGGG - Intronic
1085192431 11:74639600-74639622 AGGTGGCATGCTGTTTCTTGTGG + Intronic
1086354030 11:85973967-85973989 TGGTGGCATACTCTGGGATGAGG - Intronic
1087027240 11:93661724-93661746 GGCTGGCTTGCTCTGAGCTGCGG + Exonic
1088432799 11:109777326-109777348 ATGTGTCATGCCCTCTGCTGTGG + Intergenic
1088911151 11:114193409-114193431 AGGTGTCGTGCTCAGTGCCGAGG + Intronic
1089921399 11:122212956-122212978 AGGTGCCAGGCATTGTGCTGAGG - Intergenic
1090413859 11:126527448-126527470 AGATGCCATGCTCTGTTTTGAGG + Intronic
1090628397 11:128625497-128625519 AGGCAGCATTCTCTGGGCTGAGG - Intergenic
1090992742 11:131834428-131834450 ATGTGGTAGGCACTGTGCTGGGG + Intronic
1091274376 11:134340491-134340513 AGGTGGCAGGGTGTGTGCTTTGG + Intronic
1091820954 12:3474838-3474860 AGGTCCCATGCTAGGTGCTGGGG - Intronic
1092078147 12:5690497-5690519 AGGAGGCATTCACTGTGCTGAGG - Intronic
1092519540 12:9253716-9253738 GGCTGGCAGGCTCTGAGCTGAGG + Intergenic
1093815069 12:23535658-23535680 AGGCTGCATGCTCTGTCCAGTGG - Intronic
1095492522 12:42749394-42749416 TGTTGGCATGCTCTCTGCTCAGG + Intergenic
1097636639 12:62130625-62130647 ATGTGGCAGGCACTGTGCTAGGG + Intronic
1098442506 12:70533578-70533600 AGGTGGCAATTGCTGTGCTGTGG + Intronic
1102976626 12:117211410-117211432 ACGGGCCATGCTCTGTACTGTGG + Exonic
1103675609 12:122653282-122653304 GGATGCAATGCTCTGTGCTGTGG - Intergenic
1103914813 12:124370727-124370749 AGGTGGCATTCTCAGGGATGTGG + Intronic
1104385524 12:128348347-128348369 AGGTGGCATGATCTGTATTCAGG - Intronic
1105027839 12:132861384-132861406 CGCTGCCATGCTCCGTGCTGTGG - Intronic
1105061473 12:133155265-133155287 ATGTGTCATGCTGTGTCCTGTGG + Intronic
1106052729 13:26206778-26206800 AGGTATCATGCTAGGTGCTGAGG + Intronic
1106569509 13:30914428-30914450 AACTGGCATGCACTGTGATGAGG + Intronic
1111801298 13:92984352-92984374 AGGCCCCATGCTCAGTGCTGGGG - Intergenic
1112299287 13:98215649-98215671 AGGTGCCATGCTAGATGCTGGGG - Intronic
1113490670 13:110689268-110689290 AGGTGGCAGGTGCTGTGCTTGGG - Intronic
1113566736 13:111323804-111323826 AGCTGGCATGGTGTGTGCAGAGG - Intronic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1114267437 14:21081259-21081281 GAGTGGCAGGCTCTGTGCTAAGG - Intronic
1114527094 14:23373238-23373260 AGGTGTCCTGCCCTTTGCTGGGG - Exonic
1115105279 14:29753617-29753639 TGATGGCTTGCTCTGGGCTGGGG - Intronic
1116250484 14:42475514-42475536 AGGGTGCATGCTCTTTGCTCCGG - Intergenic
1117301656 14:54435613-54435635 AGGTGGATAGCTCTGTTCTGGGG - Intronic
1117480374 14:56137894-56137916 AGCTTGCTTGCTCTGGGCTGTGG + Intronic
1117664254 14:58039920-58039942 AAGGGAAATGCTCTGTGCTGTGG - Intronic
1118608789 14:67523427-67523449 ATGTGCCATGCACTGTGCTAAGG + Intronic
1119259667 14:73230289-73230311 AGGTGGCATCCTCTCTGAAGGGG - Intergenic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1119837070 14:77760168-77760190 TGGTGCCTTGCTCTGTCCTGGGG - Intronic
1119847194 14:77839388-77839410 AAATGGCAAGCTGTGTGCTGGGG + Intronic
1120768191 14:88350881-88350903 AAGTGGCATGTTCAGTCCTGAGG - Intergenic
1121526834 14:94625074-94625096 AGGAGGCAACTTCTGTGCTGAGG + Intergenic
1121529657 14:94643595-94643617 AGCTGCAATGCTCTGTGCTGCGG + Intergenic
1122297578 14:100713955-100713977 AGGTGGCAGGGTCTGGGATGGGG + Intergenic
1122856701 14:104563550-104563572 AGGAGGCAGGCTGTGTTCTGGGG - Intronic
1124636448 15:31367759-31367781 ACGTGCCAGGCGCTGTGCTGAGG + Intronic
1124670683 15:31635529-31635551 AGGTGCCATCCTCAGTGCAGCGG - Intronic
1125342604 15:38689571-38689593 AGGGGACAAGCTCTGTCCTGGGG + Intergenic
1128097544 15:64969450-64969472 AGGTGGTATCATCTGTGGTGGGG + Intronic
1129412232 15:75356357-75356379 AGGTGGCGGGCGCTGGGCTGGGG + Exonic
1129801615 15:78419068-78419090 ATGTGGCATGCTCTGAGCTATGG + Intergenic
1129847535 15:78774850-78774872 AAGTTGCTTGCTCTGGGCTGTGG - Intronic
1130017596 15:80199818-80199840 AGGTGGCCTGGGCTGTGGTGGGG + Intergenic
1130937517 15:88482796-88482818 GGGTGGCGTGCACAGTGCTGGGG + Intergenic
1130969205 15:88718879-88718901 AGGTTCCCTGCTCTGTGCTGTGG + Intergenic
1132030830 15:98437596-98437618 CAGGGACATGCTCTGTGCTGGGG - Exonic
1132059977 15:98684510-98684532 AGTTGGCAACCTCTATGCTGTGG + Intronic
1132551517 16:555695-555717 ACCTGGCAGGGTCTGTGCTGTGG - Intergenic
1132667551 16:1089142-1089164 AGGCTGCCTGTTCTGTGCTGGGG - Intergenic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1132950211 16:2557577-2557599 AGCTGGCCTGCCCTGTGCTTGGG + Intronic
1132964135 16:2642593-2642615 AGCTGGCCTGCCCTGTGCTTGGG - Intergenic
1133195492 16:4167048-4167070 AGCTGTGATTCTCTGTGCTGTGG - Intergenic
1133344277 16:5059808-5059830 AGGAGGTCTGCTATGTGCTGGGG + Intronic
1133403286 16:5504254-5504276 AGGCGGCCTGCTCTGTGCTCTGG - Intergenic
1133664896 16:7957341-7957363 AGGCTGCATTCTCTGTGATGTGG + Intergenic
1134423037 16:14112201-14112223 AGGTGGCAGGATCAGTGGTGTGG + Intronic
1134475248 16:14568044-14568066 AGGCGGTGTGTTCTGTGCTGAGG - Intronic
1134786872 16:16952572-16952594 ATGTTGCATGCTCTGAGATGAGG + Intergenic
1135155142 16:20046478-20046500 ATGTGCCATTTTCTGTGCTGGGG + Intronic
1135399430 16:22155966-22155988 AAGTGGCATGCTCTATTTTGTGG + Intronic
1135831172 16:25774924-25774946 AGATGCCATGCTATGAGCTGGGG - Intronic
1136274718 16:29172251-29172273 TGGTGGAATGCTCCGTGATGGGG - Intergenic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137804103 16:51287473-51287495 AGAGGGCGTGCGCTGTGCTGGGG - Intergenic
1139222263 16:65195598-65195620 AGGTATCATGCTCAGGGCTGTGG - Intergenic
1139349832 16:66327976-66327998 GGGTGGCAGGCACTGGGCTGGGG + Intergenic
1139389582 16:66598247-66598269 ATGTGACAGGCTCTGGGCTGGGG + Intergenic
1139661815 16:68425929-68425951 ACATGGAATCCTCTGTGCTGGGG - Intronic
1140477921 16:75248283-75248305 ATGTGCGAGGCTCTGTGCTGGGG - Intronic
1140623890 16:76769477-76769499 AGGTGGCATCCACTGCCCTGTGG + Intergenic
1141843619 16:86591646-86591668 ATGTGTCAAGCTCTGTGCTGAGG + Intergenic
1141997906 16:87646974-87646996 AGGTGGCATGGACAGGGCTGGGG + Intronic
1142079011 16:88138009-88138031 TGGTGGAATGCTCCGTGATGGGG - Intergenic
1142105360 16:88299605-88299627 CGGTGGCAGTCTCTGTTCTGGGG + Intergenic
1142274132 16:89107052-89107074 ATCTGGCAGGGTCTGTGCTGTGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142938986 17:3365424-3365446 AGGTGACAAACTCAGTGCTGTGG - Intergenic
1144728402 17:17513130-17513152 CTGGGGCATGCTCTGTGCTAGGG + Intronic
1145184991 17:20786376-20786398 AGGAAGCATGCTATGTGGTGGGG - Intergenic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1147211968 17:38877159-38877181 AGGTGCCAAGTGCTGTGCTGAGG + Intronic
1149363360 17:55916326-55916348 AGGCACCATGCTCTGTGCTCGGG - Intergenic
1150138896 17:62712256-62712278 AGGGGCCATGCCCTCTGCTGGGG - Intronic
1150293336 17:63993927-63993949 AGGTGGGATGCCCCGTGATGGGG - Intergenic
1151556460 17:74849349-74849371 AGGTCCCATGCTGGGTGCTGGGG - Intronic
1151620661 17:75242983-75243005 ATGTGGTTTGCACTGTGCTGCGG - Intronic
1151874088 17:76856714-76856736 AGGGGGCATGCACAGTGCAGTGG + Intergenic
1151903839 17:77035074-77035096 AAGTGGTTTGCTCTGGGCTGTGG + Intergenic
1151947493 17:77327530-77327552 GGCTGGCATGCTCTGGGCAGTGG + Intronic
1152248928 17:79201422-79201444 AGGTGGCCTGCTGTGAGCTCAGG + Intronic
1152633600 17:81421435-81421457 AGGCGTGATGCTCTGTCCTGGGG + Intronic
1153608298 18:6855899-6855921 ACGTGCCTGGCTCTGTGCTGTGG + Intronic
1155992025 18:32287733-32287755 TGGTGGTTTGCTGTGTGCTGCGG - Exonic
1156475395 18:37402722-37402744 AGGTGGGAAGCTCTGTTATGGGG - Intronic
1156478265 18:37420107-37420129 AAGTGGCCTGCTATGTGGTGGGG + Intronic
1159020707 18:63141011-63141033 AGGTGGCATGGTTTGTGTTCTGG + Intronic
1159985529 18:74836484-74836506 AAGCAGCATGCTGTGTGCTGGGG - Intronic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1160404939 18:78638962-78638984 GTGTGGCATGGTGTGTGCTGTGG - Intergenic
1160434803 18:78841551-78841573 GGGTGTCCTGCTCTCTGCTGGGG + Intergenic
1162895456 19:13762711-13762733 AGGTGGCAAGCGCGGTTCTGCGG - Exonic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1165136893 19:33675213-33675235 TGAGGGGATGCTCTGTGCTGGGG - Intronic
1165858966 19:38897017-38897039 AGGTGGCGTGCCCAGTGCTGGGG + Intronic
1167217291 19:48173066-48173088 AGGTCCCATGCTGTGGGCTGGGG + Intronic
1167489075 19:49781541-49781563 AGGGTGTGTGCTCTGTGCTGTGG + Intronic
1168281651 19:55309037-55309059 AGATGACAGGCTCTGTGTTGGGG + Intronic
1168309582 19:55453623-55453645 GGGTGGACAGCTCTGTGCTGGGG + Intronic
926093533 2:10065583-10065605 AGGTGCCATGCTGTGCGCTGTGG - Intronic
926632348 2:15147977-15147999 TGGTGCCTTGCTCTGTGCTGGGG + Intergenic
926710071 2:15872175-15872197 ATGTGGCAGGTTCTGTGCTGAGG + Intergenic
928413973 2:31075961-31075983 AGGTGTCAGGCACTGTGCTCAGG - Intronic
929119418 2:38471998-38472020 TGGTGGCATGCACTGTTCTCTGG + Intergenic
929561470 2:42959097-42959119 GGTTGGGATGCTCTGTGCAGCGG - Intergenic
929921204 2:46172757-46172779 AGAGGGGATGCCCTGTGCTGGGG + Intronic
930842972 2:55868287-55868309 AGGTACCATTCTATGTGCTGAGG + Intronic
931105075 2:59046472-59046494 AGGCGGCATGCTCTCTTCTTTGG - Intergenic
931770527 2:65493233-65493255 AGGTGCCAAGCCCTTTGCTGAGG + Intergenic
932194388 2:69770525-69770547 AGGTGGCCTGTTCTGGGATGTGG + Intronic
932435424 2:71700345-71700367 AGGTGGAACACTGTGTGCTGAGG - Intergenic
934555104 2:95282930-95282952 AGTTAGCATGCTCTGTGTTTGGG - Intronic
935633467 2:105231661-105231683 AGCTGGCATGCTGTGTGCTTGGG + Intergenic
937751916 2:125486054-125486076 AGGTGTCAGTCTCTGTACTGGGG + Intergenic
937889960 2:126931205-126931227 AGATGGCATGCTCTGGCATGAGG + Intergenic
938110167 2:128559022-128559044 AGGTGGCCTCCTCTCTGCTCCGG + Intergenic
938775672 2:134539359-134539381 AGGCGACATGCACTGTGGTGGGG + Intronic
939143166 2:138379455-138379477 TGGGGGCAAGCTCAGTGCTGGGG - Intergenic
939954441 2:148514749-148514771 AGGTGGCATGCTCTGTGCTGTGG - Intronic
941782800 2:169463026-169463048 AGGTGGCTGGCACTGTGCTAAGG + Intergenic
943003808 2:182363923-182363945 AGGTGGCATGATCTGTACCATGG - Intronic
943674866 2:190706918-190706940 TGGGGGCATGCTGTGTGGTGAGG - Intergenic
944300044 2:198113369-198113391 AGGTGACAGGCTTTGTGCTTGGG + Intronic
944439363 2:199726936-199726958 AGATGGGATGCACTGTGCTGGGG + Intergenic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
946888717 2:224251724-224251746 GGCTGGCATGCTCTGCACTGAGG - Intergenic
947084341 2:226434380-226434402 AGGTGGCTTGCTTTGGGTTGGGG - Intergenic
947156299 2:227165004-227165026 AGGTGGAATGCGCGGGGCTGGGG + Intronic
947508454 2:230728526-230728548 AGGTGGATTGCTCTGAGCTCAGG - Intronic
947617793 2:231569384-231569406 GGGTGCCAGGCTCTGTCCTGAGG - Intergenic
948230088 2:236342952-236342974 TGGAGGCATGGTCTTTGCTGTGG - Intronic
948446589 2:238038250-238038272 AGGAGGCAAGCTCTGTCCTGAGG + Intronic
948934856 2:241157098-241157120 AGCCGGCATCCTCTGTGCGGAGG - Intronic
1168832220 20:852387-852409 AGTTGGCAGGCTGTTTGCTGGGG + Intronic
1168851537 20:980416-980438 AGGGGGCATGTTCAGTCCTGGGG - Intronic
1169550046 20:6693073-6693095 GGGTACCATGCTCTGTGCAGAGG - Intergenic
1169961645 20:11166979-11167001 CGGTGTATTGCTCTGTGCTGAGG + Intergenic
1170432050 20:16284799-16284821 AGGTGGCATCTACTGTGCTGTGG - Intronic
1170608855 20:17895304-17895326 AGGGGACAGTCTCTGTGCTGAGG - Intergenic
1170709525 20:18777888-18777910 AGGTGGCTTCATCTGTGCAGTGG - Intergenic
1171158047 20:22894833-22894855 AGGTGGCATCTCCTGGGCTGGGG - Intergenic
1172067132 20:32229555-32229577 AGGAGGTATGCTATCTGCTGTGG - Intronic
1172626052 20:36347480-36347502 ATGTGCCAAGCCCTGTGCTGGGG + Intronic
1172765492 20:37348553-37348575 AGGTGGCAGGGCCTGAGCTGAGG + Intronic
1172830327 20:37828668-37828690 AGGTGGCAGGCACTGGGCTAGGG - Intronic
1173667830 20:44775318-44775340 CTGTAGCATGCTATGTGCTGTGG + Intronic
1173834377 20:46115681-46115703 AGCTGGCATGCTAAATGCTGTGG + Intergenic
1174523511 20:51153529-51153551 ATGTGCCAAGCACTGTGCTGAGG + Intergenic
1175271162 20:57735074-57735096 AGGAGGCCTGCTCTGGGCTGGGG + Intergenic
1175426814 20:58872720-58872742 AGGTTGATTGCTCTGTGCTGGGG + Intronic
1175979992 20:62733841-62733863 AGAGGGAAGGCTCTGTGCTGGGG + Intronic
1176037281 20:63045778-63045800 ATGGGGCCTGCTCTGTGCTCCGG - Intergenic
1176072844 20:63235865-63235887 GGGTCACATGCTCTGTGCAGCGG - Exonic
1176106512 20:63392110-63392132 AAGTGGCAGGCTGGGTGCTGTGG - Intergenic
1179820582 21:43934721-43934743 GCGTGGCTTGCTTTGTGCTGTGG - Intronic
1179829489 21:43987686-43987708 TGGTGACATGCTCTCTGCTCCGG + Intergenic
1179999806 21:44990364-44990386 TGGTGGCAGGCTCTGGGCAGAGG + Intergenic
1180208711 21:46280057-46280079 AGGGTGCATCCTCTGTGCTCGGG + Exonic
1181062979 22:20290800-20290822 AGCAGGCATGGTCAGTGCTGAGG + Intergenic
1181439567 22:22928814-22928836 AGGAGGGTTGGTCTGTGCTGGGG + Intergenic
1181695619 22:24591472-24591494 AGGTGATATGCTCTGTGCGTGGG + Intronic
1182903226 22:33916372-33916394 AGGTGCCATGCTCTGTGTGGAGG - Intronic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1184058742 22:42069104-42069126 TGGTGGCATGCGCTGTACTCGGG + Intronic
1184103607 22:42354649-42354671 AGGCCCCATGCTCTGTGCAGGGG - Intergenic
1184367820 22:44063706-44063728 TCGTGGCCTGCTCGGTGCTGGGG + Intronic
1184372585 22:44091994-44092016 ACGTGCCATGCTCTGGGCTGGGG + Intronic
1184413661 22:44339889-44339911 AGGGGCCCTGCTATGTGCTGGGG + Intergenic
949871860 3:8595929-8595951 TGGTGGAAAGCTCTGTGCTTGGG + Intergenic
950110641 3:10416677-10416699 AGGTCGCCAGCTCTGTGCTCTGG - Intronic
950117901 3:10463279-10463301 TGGAGGCCTGTTCTGTGCTGGGG - Intronic
950278056 3:11680842-11680864 AGGTGCCATACTAAGTGCTGAGG - Intronic
950613146 3:14138939-14138961 TGCTGGCAGGCTCTGAGCTGAGG + Intronic
950769948 3:15303347-15303369 GTGTGGCAGGCTCTGGGCTGGGG - Intronic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
953697794 3:45173234-45173256 TGGTAGCATGCACTGTTCTGCGG + Intergenic
954143874 3:48624490-48624512 AGGTGCCAGGCTCTGTGCAGGGG - Intergenic
954457148 3:50605944-50605966 AGAGGGCTTGCTCTGTGCAGTGG - Intergenic
956268638 3:67426640-67426662 AGGTGGCATGCTGGGCGCAGTGG + Intronic
957158412 3:76576548-76576570 AGGTGGCCTACTTTTTGCTGAGG + Intronic
958684451 3:97375117-97375139 AGCTGGCAGGTTTTGTGCTGGGG - Intronic
958879970 3:99658580-99658602 TGGTTTCAGGCTCTGTGCTGGGG - Intronic
959370418 3:105517688-105517710 GGGTGGCAAGCTCTGTCTTGAGG - Intronic
960341819 3:116484205-116484227 AGTGGGCAGGCTGTGTGCTGGGG + Intronic
960988613 3:123296200-123296222 TGGTTGCATGCTCAGGGCTGTGG + Exonic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
962331836 3:134485488-134485510 TGGTGCCATGCTCTGTGCTTAGG - Exonic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
963748778 3:149152694-149152716 AGGTGGCTTGGTTAGTGCTGAGG - Intronic
966419024 3:179719157-179719179 TGTTGGTAAGCTCTGTGCTGAGG - Intronic
967395938 3:189009080-189009102 AGTAGGCCTACTCTGTGCTGGGG - Intronic
973783649 4:54314939-54314961 AGGTGGGATGGGATGTGCTGGGG - Intergenic
973796739 4:54434839-54434861 AGGTGTAAGGCTCTGTGTTGAGG - Intergenic
973852301 4:54973319-54973341 AGATGGCATGTTCTGTGAGGAGG - Intergenic
975692464 4:76979381-76979403 TGGAGGCATGCTCTGTGCAGAGG + Intronic
976203943 4:82606826-82606848 AGGTGGCTTGCCCTGTGAAGTGG + Intergenic
976206202 4:82625718-82625740 AGCTGGCAACCCCTGTGCTGTGG - Intergenic
976621862 4:87136440-87136462 AGGTGGCACCCCATGTGCTGTGG - Exonic
979568116 4:122179931-122179953 AGGGGACATGCTCACTGCTGGGG - Intronic
983481803 4:168284004-168284026 AGCTGCCATGCTCTGGGCTCTGG - Intronic
984967224 4:185150018-185150040 ATGTGGCATCCTTTGTGTTGAGG + Exonic
985647005 5:1089705-1089727 AGGCTGCCTGCTCCGTGCTGGGG - Intronic
985791689 5:1931545-1931567 AGGTTGCAGGGTCAGTGCTGCGG + Intergenic
986125392 5:4879122-4879144 AGGTGGCCTGCTCTTGGCTTTGG + Intergenic
986299418 5:6466383-6466405 AGGTGGCCTGCTCTCAGGTGGGG - Intronic
987229361 5:15877112-15877134 AAATGGGATGCTGTGTGCTGGGG - Intronic
989129761 5:38095330-38095352 AGGTGGCAGGGTTTCTGCTGTGG - Intergenic
992563275 5:77973061-77973083 AAACGGCATGCTCCGTGCTGGGG + Intergenic
997528954 5:134570573-134570595 AGGTGGCAGGCTCTGGGATGTGG - Intronic
997953477 5:138260199-138260221 AGGTGACTTGCTCTGGTCTGTGG + Intronic
998186212 5:139981829-139981851 TGGGAGCTTGCTCTGTGCTGGGG - Intronic
998216431 5:140241398-140241420 AAGTGCCAGGCCCTGTGCTGAGG - Intronic
998386950 5:141762585-141762607 AGGGGACATGCTCTGGGTTGGGG + Intergenic
999711728 5:154323886-154323908 AGGTGGAATTCCCAGTGCTGCGG - Intronic
1000004696 5:157172611-157172633 AGGTGGCGTGGGCTGAGCTGCGG + Intronic
1001270886 5:170310825-170310847 AGGGGGCATGCTGTCTGCTCTGG + Intergenic
1001433216 5:171679883-171679905 AAGTTGCAAGCTCTGGGCTGGGG - Intergenic
1001922689 5:175612679-175612701 AGGTGGCATGCTTTTTAATGTGG - Intergenic
1001967497 5:175921532-175921554 TGGTGCCAGGCTCTGTGCTAGGG - Intronic
1002691706 5:181054450-181054472 AGCTGGCAGGGTCTGTGCAGAGG - Intronic
1003897693 6:10623260-10623282 AGGTGGCATGCACTGTCCCCTGG - Intronic
1004321216 6:14633207-14633229 AGGTGGCCTGCTGAGTGCTCTGG - Intergenic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1008525454 6:52403160-52403182 AGGTTGCATACCCTGTCCTGAGG + Exonic
1010720511 6:79278102-79278124 AAGTGGCATGGTCTCTGGTGGGG + Intergenic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1015938805 6:138429350-138429372 AGGAGGAATGCTATGTTCTGTGG - Intronic
1017113987 6:150959826-150959848 GGGTCTCATGCTCCGTGCTGGGG + Intronic
1017237080 6:152127699-152127721 AGGGGAGAGGCTCTGTGCTGAGG + Intronic
1017523197 6:155220135-155220157 TGTTGGCATGGTCTGTGCTGTGG + Intronic
1021022002 7:15612392-15612414 AGTGCGCATGCTCTGAGCTGTGG + Exonic
1022794136 7:33718683-33718705 AAGAGGCATGCCCTGTCCTGGGG - Intergenic
1022950147 7:35330746-35330768 TGCTGGCCTGCCCTGTGCTGTGG + Intergenic
1024543573 7:50499282-50499304 AGCTGGCAGGCTCCGTGGTGAGG - Intronic
1026363516 7:69625038-69625060 TGGTGTCATGCTCTTTGGTGAGG + Intronic
1026503514 7:70963060-70963082 AGGTGGCAACCTATGTGCTTTGG - Intergenic
1028650463 7:93145098-93145120 AGGTGGAAAGCTCTGGGGTGAGG - Intronic
1029223727 7:99009799-99009821 AGCTGGATTCCTCTGTGCTGTGG - Intronic
1029370290 7:100145859-100145881 AGGTGGATTGCTCTGAGCTCAGG + Intergenic
1029659153 7:101947519-101947541 CGTTGGCATGCCCCGTGCTGGGG - Intronic
1029664618 7:101987070-101987092 AGGTGGCAAGGCCTGAGCTGAGG - Intronic
1030550981 7:110959297-110959319 AGGTGCTTTGGTCTGTGCTGTGG - Intronic
1031999181 7:128253863-128253885 AGGTGTCAGCCTCAGTGCTGTGG + Intronic
1032406025 7:131656067-131656089 GGGCCCCATGCTCTGTGCTGTGG + Intergenic
1032662022 7:133994532-133994554 AGATGGCATGCTTTATGCAGTGG + Intronic
1033461854 7:141553606-141553628 ATATGGTAGGCTCTGTGCTGGGG - Intronic
1037827935 8:22170377-22170399 GTGTTGCATGCTCTGTGCTGGGG + Intronic
1038629596 8:29228712-29228734 AGGTGGCATGACCAATGCTGTGG + Intronic
1039521126 8:38172862-38172884 AGGGGGCATGTGCTGTTCTGGGG + Intronic
1039904282 8:41774757-41774779 ATGTGGCATGCTCTGCGGCGTGG - Intronic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041412942 8:57576645-57576667 AAGTGCAAAGCTCTGTGCTGGGG + Intergenic
1042173026 8:66010600-66010622 AGCAGCCCTGCTCTGTGCTGTGG - Intergenic
1044976106 8:97667210-97667232 AGGTGGACTGCTTTGAGCTGAGG - Intronic
1045491674 8:102674903-102674925 TGGCGAGATGCTCTGTGCTGTGG + Intergenic
1045511134 8:102812933-102812955 AGGTGGCATGCTCAAGGGTGTGG + Intergenic
1045812401 8:106238138-106238160 AGGTCTCATGCCCTGTGGTGAGG + Intergenic
1047214108 8:122863065-122863087 AGGGGGAAAGCTCTGTGCTCAGG - Intronic
1047501311 8:125443916-125443938 AGGAGGGCTGCTCTGTGATGAGG + Intergenic
1048067339 8:130983752-130983774 AGGTGTAATACTCTGTGCTGGGG + Intronic
1048321209 8:133401606-133401628 AGTTGGCTTGCTGTGGGCTGTGG + Intergenic
1049018390 8:139937538-139937560 AGGTGGCAGGGCCGGTGCTGGGG + Intronic
1049234491 8:141505668-141505690 AGGAGACATGCTCTGGGCAGAGG - Intergenic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1049251968 8:141594035-141594057 AGGGGACATGCACTGTGGTGTGG + Intergenic
1049269462 8:141686556-141686578 AGCTTGCCTTCTCTGTGCTGTGG + Intergenic
1049316894 8:141974186-141974208 AGGTGGCATCATCTGGGCTGGGG + Intergenic
1049370073 8:142260145-142260167 AGGTGGCAGGCTCTGGGTTCGGG - Intronic
1049445143 8:142626671-142626693 AAGTGGCAAGCACTGTGGTGTGG - Intergenic
1050582473 9:7075088-7075110 AGCTGGGATGCTTTCTGCTGGGG - Intronic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1051422094 9:16898885-16898907 AGGCAGTATGCTCAGTGCTGAGG - Intergenic
1051877017 9:21803551-21803573 CGGTGGGAAGCTTTGTGCTGAGG + Intronic
1052234025 9:26188736-26188758 ATGTGGCAGGCCCAGTGCTGGGG - Intergenic
1052464123 9:28808241-28808263 AGATGGCATTCTGTGGGCTGAGG - Intergenic
1052750836 9:32488335-32488357 ATGTGTCAGGCTCTGTGCTAAGG - Intronic
1053794842 9:41716905-41716927 AGGTGGCAGGCACTGCGCTTGGG + Intergenic
1054150334 9:61597913-61597935 AGGTGGCAGGCACTGCGCTTGGG - Intergenic
1054183252 9:61928963-61928985 AGGTGGCAGGCACTGCGCTTGGG + Intergenic
1054470105 9:65529019-65529041 AGGTGGCAGGCACTGCGCTTGGG - Intergenic
1054655254 9:67659511-67659533 AGGTGGCAGGCACTGCGCTTGGG - Intergenic
1054724614 9:68638093-68638115 AGGTCACATCATCTGTGCTGGGG + Intergenic
1057299581 9:93870097-93870119 AGGTGGCATGGCCTGGGCAGGGG + Intergenic
1058486262 9:105446050-105446072 ATGTGGCAGACTCTGAGCTGGGG + Intergenic
1059217217 9:112575231-112575253 ACCTGGTATGCACTGTGCTGTGG - Exonic
1060053575 9:120393945-120393967 AGGTGGCAGGCTCAGGGCAGAGG - Intronic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060420222 9:123463101-123463123 AGGTGACATTCTAGGTGCTGGGG + Intronic
1060521625 9:124297322-124297344 ATGTGCCAGGCTCTGTGCTAAGG + Intronic
1060827689 9:126696031-126696053 AGGGGGCAGGGGCTGTGCTGGGG - Intronic
1062235638 9:135506386-135506408 AGGTGGCCTTCTCTGGACTGTGG + Intergenic
1186270107 X:7877793-7877815 AGGGGGCATGCTTTGTTCTAGGG - Intergenic
1189711226 X:43814285-43814307 AGGTGGCTGCCTCTGTGCTCTGG + Intronic
1192204619 X:69087910-69087932 AGATTGCATGATCTGGGCTGAGG + Intergenic
1192703805 X:73506938-73506960 TGGTGGCATTATCTGTGCTTGGG + Intergenic
1194528520 X:95012376-95012398 AGGTGGCATGCAGGGTGCTGTGG + Intergenic
1195529281 X:105933504-105933526 ATGTGGTATGCCCTGTCCTGTGG - Intronic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1197922984 X:131615281-131615303 CGTTTGCATGCTCTGTGCTGTGG + Intergenic
1200080683 X:153574971-153574993 AGGAGACATGCTGAGTGCTGTGG - Intronic
1200798716 Y:7365386-7365408 AGGAGGGATGCTCTGTCCTGTGG + Intergenic