ID: 939955974

View in Genome Browser
Species Human (GRCh38)
Location 2:148527957-148527979
Sequence CTGTGGATCAGGAAAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939955974_939955984 28 Left 939955974 2:148527957-148527979 CCCTGCTCTTTCCTGATCCACAG No data
Right 939955984 2:148528008-148528030 GGCCAGCAGATGCCTGGCAGAGG No data
939955974_939955981 -5 Left 939955974 2:148527957-148527979 CCCTGCTCTTTCCTGATCCACAG No data
Right 939955981 2:148527975-148527997 CACAGTCTCTGACTCTGGAGGGG No data
939955974_939955978 -7 Left 939955974 2:148527957-148527979 CCCTGCTCTTTCCTGATCCACAG No data
Right 939955978 2:148527973-148527995 TCCACAGTCTCTGACTCTGGAGG No data
939955974_939955983 22 Left 939955974 2:148527957-148527979 CCCTGCTCTTTCCTGATCCACAG No data
Right 939955983 2:148528002-148528024 CTCAGTGGCCAGCAGATGCCTGG No data
939955974_939955982 7 Left 939955974 2:148527957-148527979 CCCTGCTCTTTCCTGATCCACAG No data
Right 939955982 2:148527987-148528009 CTCTGGAGGGGACTGCTCAGTGG No data
939955974_939955977 -10 Left 939955974 2:148527957-148527979 CCCTGCTCTTTCCTGATCCACAG No data
Right 939955977 2:148527970-148527992 TGATCCACAGTCTCTGACTCTGG No data
939955974_939955980 -6 Left 939955974 2:148527957-148527979 CCCTGCTCTTTCCTGATCCACAG No data
Right 939955980 2:148527974-148527996 CCACAGTCTCTGACTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939955974 Original CRISPR CTGTGGATCAGGAAAGAGCA GGG (reversed) Intergenic
No off target data available for this crispr