ID: 939956189

View in Genome Browser
Species Human (GRCh38)
Location 2:148529453-148529475
Sequence AAGGAGAGGCTGAAGGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939956189_939956193 4 Left 939956189 2:148529453-148529475 CCGTGCACCTTCAGCCTCTCCTT No data
Right 939956193 2:148529480-148529502 ACCAACCTCTTGCGACCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939956189 Original CRISPR AAGGAGAGGCTGAAGGTGCA CGG (reversed) Intergenic
No off target data available for this crispr